Incidental Mutation 'R0100:Olfr1225'
ID212471
Institutional Source Beutler Lab
Gene Symbol Olfr1225
Ensembl Gene ENSMUSG00000101918
Gene Nameolfactory receptor 1225
SynonymsMOR233-11, GA_x6K02T2Q125-50650037-50649102
MMRRC Submission 038386-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0100 (G1)
Quality Score61
Status Validated
Chromosome2
Chromosomal Location89168380-89174669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89171087 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 42 (I42F)
Ref Sequence ENSEMBL: ENSMUSP00000150915 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000188861] [ENSMUST00000216961] [ENSMUST00000217054]
Predicted Effect probably benign
Transcript: ENSMUST00000099791
AA Change: I42F

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000097379
Gene: ENSMUSG00000075098
AA Change: I42F

DomainStartEndE-ValueType
Pfam:7tm_4 29 303 4e-47 PFAM
Pfam:7tm_1 39 304 2.7e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188861
AA Change: I42F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000140442
Gene: ENSMUSG00000101918
AA Change: I42F

DomainStartEndE-ValueType
low complexity region 24 32 N/A INTRINSIC
Pfam:7tm_1 39 289 5.5e-24 PFAM
Pfam:7tm_4 138 287 2.3e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216961
AA Change: I42F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000217054
AA Change: I42F

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Meta Mutation Damage Score 0.11 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,254,011 I442T possibly damaging Het
Agrn A G 4: 156,174,958 C814R probably damaging Het
Bbof1 T A 12: 84,411,055 D31E probably benign Het
Ccdc51 C T 9: 109,091,998 Q318* probably null Het
Cpxm2 T A 7: 132,054,871 H554L possibly damaging Het
Dbr1 T A 9: 99,583,669 D433E probably benign Het
Ddx55 C T 5: 124,556,782 T91I probably damaging Het
Dhx57 T C 17: 80,275,156 D340G possibly damaging Het
Dnah1 C T 14: 31,262,152 probably null Het
Dpp9 C T 17: 56,205,854 G118D possibly damaging Het
Fam81a C T 9: 70,102,809 probably benign Het
Fat4 A C 3: 38,980,248 N2683T probably damaging Het
Fbxo47 C T 11: 97,868,606 G165S probably damaging Het
Gpatch2 C A 1: 187,225,817 A123E probably damaging Het
Greb1 T A 12: 16,680,224 Q1734L probably benign Het
Gtf2ird2 T C 5: 134,217,015 L705P probably damaging Het
H13 T A 2: 152,689,863 probably null Het
Hip1 T C 5: 135,436,453 D367G probably benign Het
Ift140 C T 17: 25,090,954 Q1112* probably null Het
Il17b A G 18: 61,690,271 M59V probably benign Het
Lpin3 T C 2: 160,905,340 Y829H probably damaging Het
Mocs3 C T 2: 168,231,190 R186C probably damaging Het
Olfr1105 T C 2: 87,033,595 T209A probably benign Het
Olfr121 T C 17: 37,752,703 F283S probably benign Het
Olfr1344 C T 7: 6,440,400 R167C probably damaging Het
Osgepl1 A G 1: 53,323,213 I405V probably damaging Het
Pdcd11 T C 19: 47,102,666 S360P probably benign Het
Plekhs1 A G 19: 56,478,502 E255G probably damaging Het
Tex22 T A 12: 113,088,772 I150N probably benign Het
Tmem106a T C 11: 101,586,258 S98P probably benign Het
Tnfrsf18 A G 4: 156,028,366 T170A probably benign Het
Trpc6 C T 9: 8,653,034 P614S probably damaging Het
Usp28 C A 9: 49,035,932 P566Q probably damaging Het
Washc5 A G 15: 59,344,098 F811L possibly damaging Het
Other mutations in Olfr1225
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03230:Olfr1225 APN 2 89171089 missense possibly damaging 0.53
IGL03381:Olfr1225 APN 2 89171179 missense possibly damaging 0.49
IGL03147:Olfr1225 UTSW 2 89170972 missense probably benign 0.03
R0373:Olfr1225 UTSW 2 89170413 missense probably benign 0.02
R0482:Olfr1225 UTSW 2 89170631 missense probably benign 0.37
R0491:Olfr1225 UTSW 2 89170360 missense probably benign 0.07
R0548:Olfr1225 UTSW 2 89170648 missense probably damaging 1.00
R1123:Olfr1225 UTSW 2 89170868 missense possibly damaging 0.89
R1511:Olfr1225 UTSW 2 89170937 missense probably damaging 1.00
R1565:Olfr1225 UTSW 2 89170627 missense probably benign 0.01
R4204:Olfr1225 UTSW 2 89170780 missense probably benign 0.13
R4580:Olfr1225 UTSW 2 89171200 missense probably benign 0.01
R4669:Olfr1225 UTSW 2 89170901 missense probably damaging 1.00
R5137:Olfr1225 UTSW 2 89170400 missense probably benign 0.00
R6391:Olfr1225 UTSW 2 89170598 missense probably benign 0.03
R6396:Olfr1225 UTSW 2 89170690 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCTGACAGTACTATCACCTCCATCC -3'
(R):5'- CCTTCACCCCAATGTTTAAAATGTGGC -3'

Sequencing Primer
(F):5'- CTCCATCCCAGTGAAGAAGTG -3'
(R):5'- GGGCACATCAACTTGTTCATAG -3'
Posted On2014-07-03