Incidental Mutation 'R0100:Mocs3'
ID212474
Institutional Source Beutler Lab
Gene Symbol Mocs3
Ensembl Gene ENSMUSG00000074576
Gene Namemolybdenum cofactor synthesis 3
SynonymsUba4, 1700020H17Rik
MMRRC Submission 038386-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock #R0100 (G1)
Quality Score53
Status Validated
Chromosome2
Chromosomal Location168230622-168232594 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 168231190 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 186 (R186C)
Ref Sequence ENSEMBL: ENSMUSP00000096670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099071] [ENSMUST00000109193] [ENSMUST00000138667] [ENSMUST00000154111]
Predicted Effect probably damaging
Transcript: ENSMUST00000099071
AA Change: R186C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096670
Gene: ENSMUSG00000074576
AA Change: R186C

DomainStartEndE-ValueType
coiled coil region 5 34 N/A INTRINSIC
Pfam:ThiF 63 303 6e-66 PFAM
RHOD 337 455 7.43e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099072
SMART Domains Protein: ENSMUSP00000096671
Gene: ENSMUSG00000078919

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 16 118 1.8e-11 PFAM
Pfam:Glyco_tranf_2_2 20 119 1.3e-8 PFAM
Pfam:Glycos_transf_2 20 119 6.3e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109193
SMART Domains Protein: ENSMUSP00000104816
Gene: ENSMUSG00000078919

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_2 2 101 1.2e-8 PFAM
Pfam:Glycos_transf_2 2 147 7.8e-36 PFAM
Pfam:Glyco_tranf_2_3 2 187 1.2e-11 PFAM
Pfam:Glyco_transf_21 34 148 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138667
SMART Domains Protein: ENSMUSP00000139070
Gene: ENSMUSG00000093752

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 24 240 1.1e-13 PFAM
Pfam:Glyco_tranf_2_2 28 153 8.4e-10 PFAM
Pfam:Glycos_transf_2 28 199 3.8e-40 PFAM
Pfam:Glyco_transf_21 87 200 1.5e-7 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142482
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150437
Predicted Effect probably benign
Transcript: ENSMUST00000154111
SMART Domains Protein: ENSMUSP00000118776
Gene: ENSMUSG00000078919

DomainStartEndE-ValueType
Pfam:Glyco_tranf_2_3 24 241 3.2e-13 PFAM
Pfam:Glyco_tranf_2_2 28 153 7.6e-10 PFAM
Pfam:Glycos_transf_2 28 199 8.1e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156800
Meta Mutation Damage Score 0.5 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Molybdenum cofactor (MoCo) is necessary for the function of all molybdoenzymes. The protein encoded by this gene adenylates and activates molybdopterin synthase, an enzyme required for biosynthesis of MoCo. This gene contains no introns. A pseudogene of this gene is present on chromosome 14. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931406P16Rik A G 7: 34,254,011 I442T possibly damaging Het
Agrn A G 4: 156,174,958 C814R probably damaging Het
Bbof1 T A 12: 84,411,055 D31E probably benign Het
Ccdc51 C T 9: 109,091,998 Q318* probably null Het
Cpxm2 T A 7: 132,054,871 H554L possibly damaging Het
Dbr1 T A 9: 99,583,669 D433E probably benign Het
Ddx55 C T 5: 124,556,782 T91I probably damaging Het
Dhx57 T C 17: 80,275,156 D340G possibly damaging Het
Dnah1 C T 14: 31,262,152 probably null Het
Dpp9 C T 17: 56,205,854 G118D possibly damaging Het
Fam81a C T 9: 70,102,809 probably benign Het
Fat4 A C 3: 38,980,248 N2683T probably damaging Het
Fbxo47 C T 11: 97,868,606 G165S probably damaging Het
Gpatch2 C A 1: 187,225,817 A123E probably damaging Het
Greb1 T A 12: 16,680,224 Q1734L probably benign Het
Gtf2ird2 T C 5: 134,217,015 L705P probably damaging Het
H13 T A 2: 152,689,863 probably null Het
Hip1 T C 5: 135,436,453 D367G probably benign Het
Ift140 C T 17: 25,090,954 Q1112* probably null Het
Il17b A G 18: 61,690,271 M59V probably benign Het
Lpin3 T C 2: 160,905,340 Y829H probably damaging Het
Olfr1105 T C 2: 87,033,595 T209A probably benign Het
Olfr121 T C 17: 37,752,703 F283S probably benign Het
Olfr1225 T A 2: 89,171,087 I42F probably benign Het
Olfr1344 C T 7: 6,440,400 R167C probably damaging Het
Osgepl1 A G 1: 53,323,213 I405V probably damaging Het
Pdcd11 T C 19: 47,102,666 S360P probably benign Het
Plekhs1 A G 19: 56,478,502 E255G probably damaging Het
Tex22 T A 12: 113,088,772 I150N probably benign Het
Tmem106a T C 11: 101,586,258 S98P probably benign Het
Tnfrsf18 A G 4: 156,028,366 T170A probably benign Het
Trpc6 C T 9: 8,653,034 P614S probably damaging Het
Usp28 C A 9: 49,035,932 P566Q probably damaging Het
Washc5 A G 15: 59,344,098 F811L possibly damaging Het
Other mutations in Mocs3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Mocs3 APN 2 168231491 missense possibly damaging 0.94
IGL01411:Mocs3 APN 2 168231377 missense probably damaging 0.98
R0052:Mocs3 UTSW 2 168231682 missense probably benign 0.03
R0367:Mocs3 UTSW 2 168231682 missense probably benign 0.03
R0368:Mocs3 UTSW 2 168231682 missense probably benign 0.03
R1183:Mocs3 UTSW 2 168231653 missense possibly damaging 0.92
R1651:Mocs3 UTSW 2 168231569 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGCCTTACAGGCTGAAATCACCCG -3'
(R):5'- GTCTGCACAGTTGGTCACTGTCTC -3'

Sequencing Primer
(F):5'- GACGAGATCCTCCGCTACAG -3'
(R):5'- GGTCACTGTCTCCGGCG -3'
Posted On2014-07-03