Incidental Mutation 'R0022:2310035C23Rik'
List |< first << previous [record 78 of 19097] next >> last >|
ID212514
Institutional Source Beutler Lab
Gene Symbol 2310035C23Rik
Ensembl Gene ENSMUSG00000026319
Gene NameRIKEN cDNA 2310035C23 gene
Synonyms
MMRRC Submission 038317-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.431) question?
Stock #R0022 (G1)
Quality Score67
Status Validated
Chromosome1
Chromosomal Location105663861-105755191 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 105691902 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000141162 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039173] [ENSMUST00000086721] [ENSMUST00000186807] [ENSMUST00000190501]
Predicted Effect probably benign
Transcript: ENSMUST00000039173
SMART Domains Protein: ENSMUSP00000039178
Gene: ENSMUSG00000026319

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
LisH 231 263 1.25e-3 SMART
coiled coil region 334 372 N/A INTRINSIC
SCOP:d1b3ua_ 532 1069 4e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086721
SMART Domains Protein: ENSMUSP00000083926
Gene: ENSMUSG00000026319

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
coiled coil region 197 232 N/A INTRINSIC
LisH 255 287 1.25e-3 SMART
coiled coil region 358 396 N/A INTRINSIC
SCOP:d1b3ua_ 556 1093 5e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185692
Predicted Effect probably benign
Transcript: ENSMUST00000186807
SMART Domains Protein: ENSMUSP00000140699
Gene: ENSMUSG00000026319

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
coiled coil region 197 232 N/A INTRINSIC
LisH 255 287 3.9e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189091
Predicted Effect probably benign
Transcript: ENSMUST00000190501
SMART Domains Protein: ENSMUSP00000141162
Gene: ENSMUSG00000026319

DomainStartEndE-ValueType
low complexity region 7 14 N/A INTRINSIC
low complexity region 20 28 N/A INTRINSIC
low complexity region 35 47 N/A INTRINSIC
low complexity region 76 86 N/A INTRINSIC
low complexity region 107 119 N/A INTRINSIC
low complexity region 142 154 N/A INTRINSIC
LisH 231 263 1.25e-3 SMART
coiled coil region 334 372 N/A INTRINSIC
SCOP:d1b3ua_ 532 1069 4e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191293
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 93.8%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik C T 1: 37,628,245 R240Q probably damaging Het
Agl A T 3: 116,793,836 probably null Het
Arhgap29 G A 3: 121,988,937 V91I possibly damaging Het
Aste1 T A 9: 105,396,624 L21* probably null Het
Bpifb5 A T 2: 154,230,348 D325V probably damaging Het
Btbd10 G A 7: 113,325,781 Q287* probably null Het
Cdc20 T A 4: 118,435,489 H354L probably damaging Het
Cdhr3 G A 12: 33,082,264 T120I probably damaging Het
Col5a2 G A 1: 45,383,683 R1125* probably null Het
Col9a3 A G 2: 180,619,756 D613G probably damaging Het
Coro7 C T 16: 4,633,304 R507H probably benign Het
Crebbp A T 16: 4,085,228 V2049E probably damaging Het
Cryga T C 1: 65,103,223 I4V probably damaging Het
D930020B18Rik A G 10: 121,671,770 T138A probably damaging Het
Dclre1b G T 3: 103,803,148 H482Q probably benign Het
Dpy19l2 A G 9: 24,696,124 S14P probably benign Het
Elavl3 C A 9: 22,036,871 probably benign Het
Ephb6 T C 6: 41,614,569 V220A probably damaging Het
Exoc7 A T 11: 116,297,582 I297N possibly damaging Het
Gdpd4 A T 7: 97,982,875 N332Y probably damaging Het
Ggct C A 6: 54,985,902 E175* probably null Het
Gm5316 T C 6: 122,900,395 noncoding transcript Het
Hoxa7 T C 6: 52,217,383 N8S probably damaging Het
Ifi208 A G 1: 173,683,046 T256A possibly damaging Het
Il12rb2 A G 6: 67,298,919 F630S probably damaging Het
Kit A G 5: 75,622,997 N378S probably benign Het
Lmntd1 T A 6: 145,429,990 Y74F probably benign Het
Lrp1b A T 2: 40,998,038 probably benign Het
Ltbp1 T A 17: 75,364,360 V1194D probably damaging Het
Mc5r T G 18: 68,338,782 S71A probably benign Het
Mcm7 T C 5: 138,164,719 *390W probably null Het
Myo18a T C 11: 77,843,233 probably null Het
Naa25 C A 5: 121,417,976 L276M probably damaging Het
Nlrp1a T G 11: 71,123,381 T348P probably damaging Het
Nlrp1b T G 11: 71,161,929 K888T possibly damaging Het
Olfr1276 A G 2: 111,257,649 Y178C probably benign Het
Pabpc6 A T 17: 9,669,216 N135K probably benign Het
Pdzd2 G A 15: 12,371,605 A2568V possibly damaging Het
Pik3r2 A G 8: 70,770,901 F346S probably damaging Het
Pkd1 T C 17: 24,594,819 W4086R probably damaging Het
Plekhb2 G A 1: 34,866,239 probably benign Het
Plxnb2 A G 15: 89,163,276 probably null Het
Pmfbp1 C T 8: 109,525,407 R395W probably damaging Het
Pnldc1 A G 17: 12,890,119 Y497H probably damaging Het
Ppp1ca T G 19: 4,194,581 V213G possibly damaging Het
Rapgef2 G A 3: 79,087,900 R814C probably damaging Het
Rnasel A T 1: 153,760,775 I634F probably damaging Het
Rnf157 A T 11: 116,349,450 probably benign Het
Ryr3 A G 2: 112,640,666 S4567P probably damaging Het
Smcr8 T A 11: 60,780,359 W778R probably damaging Het
Stat1 T A 1: 52,140,630 L333Q probably damaging Het
Strc A G 2: 121,368,393 L1391P probably damaging Het
Tek G A 4: 94,837,272 V592M probably damaging Het
Top1 A C 2: 160,702,799 K278N possibly damaging Het
Utrn C T 10: 12,709,956 probably benign Het
Wdr7 T C 18: 63,777,634 I699T probably damaging Het
Zfp30 A G 7: 29,792,435 E119G possibly damaging Het
Other mutations in 2310035C23Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:2310035C23Rik APN 1 105696599 splice site probably benign
IGL02393:2310035C23Rik APN 1 105687368 missense probably damaging 1.00
IGL02655:2310035C23Rik APN 1 105678246 missense probably damaging 1.00
IGL02992:2310035C23Rik APN 1 105719464 missense possibly damaging 0.89
IGL03170:2310035C23Rik APN 1 105735955 missense probably damaging 0.99
IGL03050:2310035C23Rik UTSW 1 105726381 missense probably damaging 0.98
R0399:2310035C23Rik UTSW 1 105750959 splice site probably benign
R1243:2310035C23Rik UTSW 1 105750364 missense probably damaging 1.00
R1563:2310035C23Rik UTSW 1 105719534 missense probably damaging 1.00
R1760:2310035C23Rik UTSW 1 105719444 splice site probably benign
R1894:2310035C23Rik UTSW 1 105664576 missense probably benign 0.12
R2036:2310035C23Rik UTSW 1 105743254 missense probably damaging 1.00
R2428:2310035C23Rik UTSW 1 105746126 missense possibly damaging 0.88
R2905:2310035C23Rik UTSW 1 105691994 missense probably benign 0.04
R3121:2310035C23Rik UTSW 1 105725799 missense probably benign 0.15
R3750:2310035C23Rik UTSW 1 105753577 missense probably damaging 1.00
R3886:2310035C23Rik UTSW 1 105692213 missense probably benign 0.14
R4284:2310035C23Rik UTSW 1 105721287 missense probably damaging 0.98
R4671:2310035C23Rik UTSW 1 105718859 missense probably benign 0.00
R4706:2310035C23Rik UTSW 1 105692279 missense probably benign 0.28
R4760:2310035C23Rik UTSW 1 105721305 missense probably benign 0.17
R4776:2310035C23Rik UTSW 1 105719535 nonsense probably null
R5031:2310035C23Rik UTSW 1 105664514 missense probably damaging 1.00
R5051:2310035C23Rik UTSW 1 105691986 missense possibly damaging 0.85
R5085:2310035C23Rik UTSW 1 105678180 missense probably damaging 0.99
R5104:2310035C23Rik UTSW 1 105731240 missense probably benign 0.45
R5187:2310035C23Rik UTSW 1 105718809 nonsense probably null
R5259:2310035C23Rik UTSW 1 105721376 missense probably benign 0.01
R5435:2310035C23Rik UTSW 1 105741250 intron probably benign
R5444:2310035C23Rik UTSW 1 105726384 missense possibly damaging 0.60
R5490:2310035C23Rik UTSW 1 105719501 missense probably damaging 0.99
R5513:2310035C23Rik UTSW 1 105750973 missense probably damaging 0.99
R5556:2310035C23Rik UTSW 1 105693167 missense probably benign
R5734:2310035C23Rik UTSW 1 105703883 intron probably benign
R5779:2310035C23Rik UTSW 1 105687347 missense probably damaging 1.00
R5822:2310035C23Rik UTSW 1 105718856 missense probably damaging 1.00
R5878:2310035C23Rik UTSW 1 105692960 missense probably benign
R6015:2310035C23Rik UTSW 1 105691958 missense probably damaging 1.00
R6051:2310035C23Rik UTSW 1 105721272 missense probably damaging 1.00
R6266:2310035C23Rik UTSW 1 105731282 critical splice donor site probably null
R6556:2310035C23Rik UTSW 1 105726440 missense probably damaging 1.00
R6571:2310035C23Rik UTSW 1 105692982 missense probably benign
R6612:2310035C23Rik UTSW 1 105692007 missense possibly damaging 0.72
R6852:2310035C23Rik UTSW 1 105753595 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- agctccatcccagtccATCTTTGATA -3'
(R):5'- CGTTGCCTAAAATTGGTGTAAGAGCCT -3'

Sequencing Primer
(F):5'- cctctgcctcctttgtcc -3'
(R):5'- GGTGTAAGAGCCTCTAATTCATCTTC -3'
Posted On2014-07-08