Incidental Mutation 'R0433:Nr1h2'
ID212543
Institutional Source Beutler Lab
Gene Symbol Nr1h2
Ensembl Gene ENSMUSG00000060601
Gene Namenuclear receptor subfamily 1, group H, member 2
SynonymsRIP15, LXRB, Unr2, LXRbeta
MMRRC Submission 038635-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.683) question?
Stock #R0433 (G1)
Quality Score30
Status Validated
Chromosome7
Chromosomal Location44549616-44553951 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 44549987 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Glutamine at position 365 (*365Q)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049343] [ENSMUST00000073488] [ENSMUST00000107910] [ENSMUST00000107911] [ENSMUST00000107912] [ENSMUST00000128600] [ENSMUST00000142298] [ENSMUST00000145956] [ENSMUST00000151793] [ENSMUST00000167197] [ENSMUST00000207737] [ENSMUST00000208366] [ENSMUST00000209017]
Predicted Effect probably benign
Transcript: ENSMUST00000049343
SMART Domains Protein: ENSMUSP00000039776
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 2.53e-161 SMART
Blast:POLBc 790 837 1e-18 BLAST
Pfam:zf-C4pol 1010 1080 5.1e-22 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000073488
AA Change: *447Q
SMART Domains Protein: ENSMUSP00000073188
Gene: ENSMUSG00000060601
AA Change: *447Q

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
ZnF_C4 75 148 5.81e-32 SMART
low complexity region 153 188 N/A INTRINSIC
low complexity region 190 202 N/A INTRINSIC
HOLI 258 417 2.08e-42 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107910
AA Change: *444Q
SMART Domains Protein: ENSMUSP00000103543
Gene: ENSMUSG00000060601
AA Change: *444Q

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C4 72 145 5.81e-32 SMART
low complexity region 150 185 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
HOLI 255 414 2.08e-42 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107911
AA Change: *444Q
SMART Domains Protein: ENSMUSP00000103544
Gene: ENSMUSG00000060601
AA Change: *444Q

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 52 63 N/A INTRINSIC
ZnF_C4 72 145 5.81e-32 SMART
low complexity region 150 185 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
HOLI 255 414 2.08e-42 SMART
Predicted Effect probably null
Transcript: ENSMUST00000107912
AA Change: *447Q
SMART Domains Protein: ENSMUSP00000103545
Gene: ENSMUSG00000060601
AA Change: *447Q

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
ZnF_C4 75 148 5.81e-32 SMART
low complexity region 153 188 N/A INTRINSIC
low complexity region 190 202 N/A INTRINSIC
HOLI 258 417 2.08e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128354
Predicted Effect probably benign
Transcript: ENSMUST00000128600
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132769
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136611
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137674
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138746
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141901
Predicted Effect probably benign
Transcript: ENSMUST00000142298
Predicted Effect probably benign
Transcript: ENSMUST00000145956
SMART Domains Protein: ENSMUSP00000117844
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 65 108 2e-8 BLAST
PDB:3IAY|A 76 151 7e-8 PDB
SCOP:d1tgoa1 117 153 3e-10 SMART
Blast:POLBc 130 153 7e-7 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000151793
SMART Domains Protein: ENSMUSP00000117157
Gene: ENSMUSG00000038644

DomainStartEndE-ValueType
coiled coil region 34 58 N/A INTRINSIC
Blast:POLBc 66 108 1e-7 BLAST
low complexity region 212 225 N/A INTRINSIC
Blast:POLBc 227 279 1e-19 BLAST
POLBc 306 763 7.8e-164 SMART
Blast:POLBc 790 837 1e-18 BLAST
low complexity region 914 938 N/A INTRINSIC
low complexity region 959 980 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000167197
AA Change: *447Q
SMART Domains Protein: ENSMUSP00000126788
Gene: ENSMUSG00000060601
AA Change: *447Q

DomainStartEndE-ValueType
low complexity region 17 28 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
ZnF_C4 75 148 5.81e-32 SMART
low complexity region 153 188 N/A INTRINSIC
low complexity region 190 202 N/A INTRINSIC
HOLI 258 417 2.08e-42 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207550
Predicted Effect probably benign
Transcript: ENSMUST00000207737
Predicted Effect probably null
Transcript: ENSMUST00000208322
AA Change: *365Q
Predicted Effect probably benign
Transcript: ENSMUST00000208366
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208368
Predicted Effect probably benign
Transcript: ENSMUST00000209017
Meta Mutation Damage Score 0.654 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.3%
Validation Efficiency 99% (108/109)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The liver X receptors, LXRA (NR1H3; MIM 602423) and LXRB, form a subfamily of the nuclear receptor superfamily and are key regulators of macrophage function, controlling transcriptional programs involved in lipid homeostasis and inflammation. The inducible LXRA is highly expressed in liver, adrenal gland, intestine, adipose tissue, macrophages, lung, and kidney, whereas LXRB is ubiquitously expressed. Ligand-activated LXRs form obligate heterodimers with retinoid X receptors (RXRs; see MIM 180245) and regulate expression of target genes containing LXR response elements (summary by Korf et al., 2009 [PubMed 19436111]).[supplied by OMIM, Jan 2010]
PHENOTYPE: Homozygous null mutations cause altered lipid, cholesterol and glucose metabolism and may lead to elevated cartilage matrix catabolism and PGE2 production, lipid-laden uterus myocytes and Sertoli cells, impaired uterus contractility and parturition, and higher susceptibility to bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110032F04Rik T C 3: 68,870,303 V199A possibly damaging Het
2410089E03Rik T C 15: 8,216,562 S1473P probably benign Het
Abcb5 T C 12: 118,877,810 M967V probably benign Het
Adcy10 T A 1: 165,552,022 L951Q probably damaging Het
Amer2 A T 14: 60,378,583 S76C probably damaging Het
Atad1 T C 19: 32,698,477 I182M probably benign Het
Bpi A G 2: 158,258,419 D42G probably damaging Het
C7 G T 15: 4,988,916 T815K probably damaging Het
Cacna1g T A 11: 94,459,207 D604V probably benign Het
Camk1g A G 1: 193,354,058 F165L probably damaging Het
Ccdc69 C T 11: 55,052,890 probably null Het
Ccser2 A C 14: 36,918,529 F37L probably damaging Het
Cfap43 A G 19: 47,825,771 F208S probably benign Het
Cfap54 G A 10: 92,979,080 probably benign Het
Cfap69 A C 5: 5,649,853 D62E probably damaging Het
Cnksr2 C A X: 157,888,557 M483I probably benign Het
Cnksr2 A T X: 157,888,558 M483K probably benign Het
Cog8 T C 8: 107,056,478 S60G possibly damaging Het
Col4a3 C T 1: 82,670,219 P484S unknown Het
Col6a4 C T 9: 106,067,994 G974R probably damaging Het
Dbnl T G 11: 5,796,825 probably null Het
Dhcr7 T C 7: 143,840,463 C114R possibly damaging Het
Dnah2 C A 11: 69,459,288 D2340Y probably damaging Het
Dusp10 T A 1: 184,069,196 Y387N probably damaging Het
Eipr1 C T 12: 28,859,331 T199I possibly damaging Het
Emc2 T G 15: 43,497,124 probably null Het
Enpp3 A G 10: 24,820,597 S147P probably benign Het
Fam133b T A 5: 3,558,560 probably benign Het
Fam205c A G 4: 42,874,013 probably benign Het
Fat1 C A 8: 45,024,649 T2244K possibly damaging Het
Fbn1 A G 2: 125,348,215 S1453P possibly damaging Het
Fez2 A T 17: 78,418,047 F13I probably damaging Het
Ggnbp2 T C 11: 84,836,420 K530R probably damaging Het
Gm597 A T 1: 28,777,342 Y536* probably null Het
Gpa33 T C 1: 166,163,761 probably benign Het
Gpr142 T C 11: 114,805,997 I123T probably damaging Het
Il21 T G 3: 37,232,535 I11L possibly damaging Het
Klhl7 A G 5: 24,127,702 E86G probably damaging Het
Klk10 G T 7: 43,781,565 A11S possibly damaging Het
Knl1 A T 2: 119,104,061 D2115V probably damaging Het
Lonp2 A G 8: 86,633,954 D185G probably damaging Het
Lrrc47 T C 4: 154,018,365 probably benign Het
Lrrcc1 A G 3: 14,559,374 I698V probably damaging Het
Lzts2 T C 19: 45,021,676 V83A possibly damaging Het
Melk C A 4: 44,340,614 probably benign Het
Mical1 G A 10: 41,479,490 V150I probably benign Het
Morn3 C A 5: 123,039,333 M129I probably benign Het
Mroh2b T A 15: 4,941,634 D1040E probably benign Het
Mroh5 T C 15: 73,790,028 N438S probably benign Het
Mroh5 T A 15: 73,790,808 Q387L probably damaging Het
Myh15 A G 16: 49,145,236 D1168G probably damaging Het
Nek10 A G 14: 14,860,927 E493G probably benign Het
Nipsnap3a A G 4: 53,000,316 Y227C probably damaging Het
Nlrp9c T A 7: 26,385,819 T112S probably benign Het
Nphp4 T C 4: 152,518,172 V401A probably benign Het
Olfr1339 T C 4: 118,735,090 V187A probably benign Het
Olfr474 T C 7: 107,955,262 I207T probably damaging Het
Pacs2 T A 12: 113,056,844 V279D possibly damaging Het
Pdcd2 C T 17: 15,526,384 C171Y probably benign Het
Pde11a T A 2: 76,337,706 D301V possibly damaging Het
Pfpl T G 19: 12,429,475 N363K probably damaging Het
Phf14 T A 6: 11,933,743 S201R probably damaging Het
Pip4k2c G A 10: 127,208,946 P66S probably benign Het
Pou2f3 G T 9: 43,127,398 H392N probably benign Het
Pou3f1 G T 4: 124,658,904 G400C probably damaging Het
Ptprg T C 14: 12,220,620 I1219T probably damaging Het
Rfx6 A G 10: 51,720,028 D435G probably damaging Het
Rhpn2 T A 7: 35,385,474 S598T probably benign Het
Sdccag8 C A 1: 176,844,821 probably null Het
Sec16b C A 1: 157,534,709 Y43* probably null Het
Sele T C 1: 164,049,244 Y30H possibly damaging Het
Sgsm2 C T 11: 74,858,190 probably null Het
Slc45a2 T C 15: 11,025,745 Y394H probably benign Het
Slc4a10 T G 2: 62,289,983 I788S probably benign Het
Slmap A T 14: 26,453,594 L161* probably null Het
Slx4 A T 16: 3,986,018 D977E probably benign Het
Spen A T 4: 141,483,758 M608K unknown Het
St8sia4 G C 1: 95,591,704 T353R probably damaging Het
Stab2 G T 10: 86,843,491 probably benign Het
Stx12 C T 4: 132,858,430 G213D probably damaging Het
Synj2 A T 17: 6,033,848 N270Y probably damaging Het
Tdrd9 C T 12: 112,025,581 R438* probably null Het
Tert T C 13: 73,627,081 Y18H probably damaging Het
Tph1 A T 7: 46,653,821 F244L probably damaging Het
Triobp T C 15: 78,968,201 F852L possibly damaging Het
Trpv1 T C 11: 73,253,008 probably benign Het
Uggt2 A T 14: 119,075,329 probably null Het
Ulk4 A G 9: 121,044,819 I1182T probably benign Het
Uqcc1 A G 2: 155,910,368 Y98H probably damaging Het
Usp25 A G 16: 77,109,217 I854V probably benign Het
Usp50 T C 2: 126,761,544 S361G probably damaging Het
Uspl1 C A 5: 149,214,815 Q743K probably damaging Het
Vmn2r3 A G 3: 64,275,633 V215A possibly damaging Het
Vmn2r61 A T 7: 42,265,911 H94L probably benign Het
Vps37c T C 19: 10,713,029 V285A probably benign Het
Vwa8 T C 14: 79,062,676 V983A probably damaging Het
Wdr78 T C 4: 103,103,253 N67D probably benign Het
Zcchc9 C T 13: 91,805,962 R58H probably benign Het
Zdbf2 T C 1: 63,306,143 V1227A possibly damaging Het
Zfp292 T C 4: 34,839,959 K64E probably damaging Het
Zfp948 A G 17: 21,587,502 T319A probably benign Het
Zp3r T G 1: 130,577,133 probably benign Het
Other mutations in Nr1h2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02211:Nr1h2 APN 7 44550460 missense probably damaging 1.00
IGL02327:Nr1h2 APN 7 44551500 unclassified probably benign
bisogno UTSW 7 44550013 missense probably damaging 1.00
quiero UTSW 7 44552537 missense probably benign 0.27
R0179:Nr1h2 UTSW 7 44552265 intron probably null
R0597:Nr1h2 UTSW 7 44552260 intron probably benign
R2432:Nr1h2 UTSW 7 44551367 missense possibly damaging 0.46
R4635:Nr1h2 UTSW 7 44552537 missense probably benign 0.27
R4662:Nr1h2 UTSW 7 44550431 missense probably damaging 1.00
R4675:Nr1h2 UTSW 7 44552555 missense possibly damaging 0.66
R4782:Nr1h2 UTSW 7 44550499 missense possibly damaging 0.93
R5064:Nr1h2 UTSW 7 44551649 missense possibly damaging 0.82
R5191:Nr1h2 UTSW 7 44550416 missense probably damaging 1.00
R6266:Nr1h2 UTSW 7 44552052 nonsense probably null
R6933:Nr1h2 UTSW 7 44550013 missense probably damaging 1.00
R7323:Nr1h2 UTSW 7 44550322 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGACCCTCACCACTCTTGGAAGAC -3'
(R):5'- TCCTCTCCTACACGAGGATCAAGC -3'

Sequencing Primer
(F):5'- CCACTCTTGGAAGACTCAATGG -3'
(R):5'- GGCTTTCCAGACAAAGCTG -3'
Posted On2014-07-09