Incidental Mutation 'R0076:Ing3'
ID212551
Institutional Source Beutler Lab
Gene Symbol Ing3
Ensembl Gene ENSMUSG00000029670
Gene Nameinhibitor of growth family, member 3
Synonyms1300013A07Rik, P47ING3
MMRRC Submission 038363-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.965) question?
Stock #R0076 (G1)
Quality Score31
Status Validated
Chromosome6
Chromosomal Location21949571-21976038 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21952171 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 48 (M48T)
Ref Sequence ENSEMBL: ENSMUSP00000138244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031680] [ENSMUST00000115389] [ENSMUST00000136200] [ENSMUST00000149728] [ENSMUST00000151473] [ENSMUST00000152877]
Predicted Effect probably benign
Transcript: ENSMUST00000031680
AA Change: M48T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031680
Gene: ENSMUSG00000029670
AA Change: M48T

DomainStartEndE-ValueType
Pfam:ING 3 104 2.7e-31 PFAM
low complexity region 214 239 N/A INTRINSIC
low complexity region 308 345 N/A INTRINSIC
PHD 365 410 4e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115389
AA Change: M48T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111047
Gene: ENSMUSG00000029670
AA Change: M48T

DomainStartEndE-ValueType
Pfam:ING 2 104 1.5e-33 PFAM
low complexity region 203 228 N/A INTRINSIC
low complexity region 297 334 N/A INTRINSIC
PHD 354 399 6.39e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136200
SMART Domains Protein: ENSMUSP00000138656
Gene: ENSMUSG00000029670

DomainStartEndE-ValueType
Pfam:ING 2 41 1.5e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144534
Predicted Effect probably benign
Transcript: ENSMUST00000149728
AA Change: M33T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145391
Gene: ENSMUSG00000029670
AA Change: M33T

DomainStartEndE-ValueType
Pfam:ING 1 89 6.8e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151473
AA Change: M24T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120651
Gene: ENSMUSG00000029670
AA Change: M24T

DomainStartEndE-ValueType
Pfam:ING 2 80 1.9e-19 PFAM
low complexity region 190 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152877
AA Change: M48T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000138244
Gene: ENSMUSG00000029670
AA Change: M48T

DomainStartEndE-ValueType
Pfam:ING 2 89 1.5e-27 PFAM
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.9%
  • 10x: 97.7%
  • 20x: 96.0%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to ING1, a tumor suppressor protein that can interact with TP53, inhibit cell growth, and induce apoptosis. This protein contains a PHD-finger, which is a common motif in proteins involved in chromatin remodeling. This gene can activate p53 trans-activated promoters, including promoters of p21/waf1 and bax. Overexpression of this gene has been shown to inhibit cell growth and induce apoptosis. Allelic loss and reduced expression of this gene were detected in head and neck cancers. Two alternatively spliced transcript variants encoding different isoforms have been observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acpp A G 9: 104,324,218 probably benign Het
Ankrd17 T A 5: 90,244,406 K1693* probably null Het
Car10 G A 11: 93,490,597 E129K possibly damaging Het
Ccnd1 A C 7: 144,939,665 V10G probably benign Het
Cd19 T C 7: 126,410,862 D406G probably damaging Het
Col4a1 G A 8: 11,218,713 P1009L probably damaging Het
Col9a1 G A 1: 24,237,497 probably null Het
Crlf3 A T 11: 80,056,601 probably benign Het
Dock3 A C 9: 106,911,486 probably benign Het
Dus1l A T 11: 120,792,808 probably benign Het
Dvl2 G A 11: 70,008,100 E438K probably damaging Het
Eif3g A G 9: 20,897,753 F85S probably damaging Het
Fam234b A G 6: 135,227,226 M456V probably benign Het
Fbxo47 G A 11: 97,857,655 probably benign Het
Galntl5 A G 5: 25,186,072 probably null Het
Gm11437 T C 11: 84,148,636 T288A possibly damaging Het
Gm5546 T A 3: 104,353,132 noncoding transcript Het
Gmfb C A 14: 46,817,455 A11S probably benign Het
Hnrnpa3 G T 2: 75,661,696 R52L probably damaging Het
Kmt2a A G 9: 44,830,059 probably benign Het
Maats1 G A 16: 38,302,684 Q661* probably null Het
Megf8 G A 7: 25,353,958 probably null Het
Pex3 A G 10: 13,535,594 V180A probably benign Het
Pou6f1 G A 15: 100,587,836 Q106* probably null Het
Ror2 T C 13: 53,113,074 M442V probably benign Het
Rspo1 G A 4: 124,991,397 R22Q probably benign Het
Sec1 A G 7: 45,678,891 V244A probably damaging Het
Serac1 A G 17: 6,064,937 probably benign Het
Sgcz A G 8: 37,545,442 probably benign Het
Slc16a7 A T 10: 125,228,070 V466D probably benign Het
Tbl1xr1 T A 3: 22,189,785 D74E probably benign Het
Ube3b G T 5: 114,408,217 probably null Het
Ugt2b37 A G 5: 87,254,221 S184P probably benign Het
Other mutations in Ing3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01721:Ing3 APN 6 21968880 splice site probably benign
IGL02330:Ing3 APN 6 21952121 missense probably benign 0.00
IGL02668:Ing3 APN 6 21950059 missense probably damaging 0.98
IGL02897:Ing3 APN 6 21969326 missense probably benign 0.14
IGL03065:Ing3 APN 6 21971222 missense probably benign
R0513:Ing3 UTSW 6 21970035 missense probably damaging 0.98
R0711:Ing3 UTSW 6 21971237 nonsense probably null
R2369:Ing3 UTSW 6 21950091 missense probably damaging 0.98
R4660:Ing3 UTSW 6 21973711 utr 3 prime probably benign
R4672:Ing3 UTSW 6 21965730 splice site probably null
R5557:Ing3 UTSW 6 21968909 missense possibly damaging 0.95
R5682:Ing3 UTSW 6 21968950 missense probably damaging 0.98
R5773:Ing3 UTSW 6 21971835 missense probably damaging 1.00
R5774:Ing3 UTSW 6 21967689 missense probably benign
R5914:Ing3 UTSW 6 21968905 missense probably benign 0.18
R5976:Ing3 UTSW 6 21971174 missense probably benign 0.09
R6265:Ing3 UTSW 6 21953814 missense probably damaging 0.99
R7239:Ing3 UTSW 6 21952194 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGCCATTAACTTTGATTTCAGTGCGG -3'
(R):5'- TCATAAGTGCCCTCACTCCATATCCAG -3'

Sequencing Primer
(F):5'- GCGTAGATCCTTGTCTGTACAATTC -3'
(R):5'- TACTATCTCTCCTAGAGGGTCCCA -3'
Posted On2014-07-09