Mutagenetix > Incidental Mutation

Incidental Mutation 'R0076:Pex3'

212561

Institutional Source

Beutler Lab

Gene Symbol

Pex3

Ensembl Gene

ENSMUSG00000019809

Gene Name

peroxisomal biogenesis factor 3

Synonyms

2900010N04Rik, 2810027F19Rik, 1700014F15Rik

MMRRC Submission

038363-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0076 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

13399586-13428886 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 13411338 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 180 (V180A)

Ref Sequence

ENSEMBL: ENSMUSP00000128512 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000019945] [ENSMUST00000105539] [ENSMUST00000105541] [ENSMUST00000170376]

AlphaFold

Q9QXY9

Predicted Effect

probably benign
Transcript: ENSMUST00000019945
AA Change: V180A

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000019945
Gene: ENSMUSG00000019809
AA Change: V180A

Domain	Start	End	E-Value	Type
Pfam:Peroxin-3	4	99	9.9e-23	PFAM
Pfam:Peroxin-3	94	363	5.7e-53	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105539
AA Change: V114A

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000101178
Gene: ENSMUSG00000019809
AA Change: V114A

Domain	Start	End	E-Value	Type
Pfam:Peroxin-3	28	298	6.1e-83	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000105541
AA Change: V114A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000101180
Gene: ENSMUSG00000019809
AA Change: V114A

Domain	Start	End	E-Value	Type
Pfam:Peroxin-3	28	286	2e-74	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125207

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133332

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145337

Predicted Effect

probably benign
Transcript: ENSMUST00000170376
AA Change: V180A

PolyPhen 2 Score 0.076 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000128512
Gene: ENSMUSG00000019809
AA Change: V180A

Domain	Start	End	E-Value	Type
Pfam:Peroxin-3	2	97	2.4e-35	PFAM
Pfam:Peroxin-3	94	352	7.3e-75	PFAM

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.3%
3x: 98.9%
10x: 97.7%
20x: 96.0%

Validation Efficiency

100% (50/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is involved in peroxisome biosynthesis and integrity. It assembles membrane vesicles before the matrix proteins are translocated. Peroxins (PEXs) are proteins that are essential for the assembly of functional peroxisomes. The peroxisome biogenesis disorders (PBDs) are a group of genetically heterogeneous autosomal recessive, lethal diseases characterized by multiple defects in peroxisome function. The peroxisomal biogenesis disorders are a heterogeneous group with at least 14 complementation groups and with more than 1 phenotype being observed in cases falling into particular complementation groups. Although the clinical features of PBD patients vary, cells from all PBD patients exhibit a defect in the import of one or more classes of peroxisomal matrix proteins into the organelle. Defects in this gene are a cause Zellweger syndrome (ZWS). [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous mutants exhibit abnormal sebaceous gland, hair follicle bulge, and cornea morphology. An increase in B and T cell numbers and mean platelet volume, and vertebral transformation are also seen. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp3	A	G	9: 104,201,417 (GRCm39)		probably benign	Het
Ankrd17	T	A	5: 90,392,265 (GRCm39)	K1693*	probably null	Het
Car10	G	A	11: 93,381,423 (GRCm39)	E129K	possibly damaging	Het
Ccnd1	A	C	7: 144,493,402 (GRCm39)	V10G	probably benign	Het
Cd19	T	C	7: 126,010,034 (GRCm39)	D406G	probably damaging	Het
Cfap91	G	A	16: 38,123,046 (GRCm39)	Q661*	probably null	Het
Col4a1	G	A	8: 11,268,713 (GRCm39)	P1009L	probably damaging	Het
Col9a1	G	A	1: 24,276,578 (GRCm39)		probably null	Het
Crlf3	A	T	11: 79,947,427 (GRCm39)		probably benign	Het
Dock3	A	C	9: 106,788,685 (GRCm39)		probably benign	Het
Dus1l	A	T	11: 120,683,634 (GRCm39)		probably benign	Het
Dvl2	G	A	11: 69,898,926 (GRCm39)	E438K	probably damaging	Het
Eif3g	A	G	9: 20,809,049 (GRCm39)	F85S	probably damaging	Het
Fam234b	A	G	6: 135,204,224 (GRCm39)	M456V	probably benign	Het
Fbxo47	G	A	11: 97,748,481 (GRCm39)		probably benign	Het
Galntl5	A	G	5: 25,391,070 (GRCm39)		probably null	Het
Gm11437	T	C	11: 84,039,462 (GRCm39)	T288A	possibly damaging	Het
Gm5546	T	A	3: 104,260,448 (GRCm39)		noncoding transcript	Het
Gmfb	C	A	14: 47,054,912 (GRCm39)	A11S	probably benign	Het
Hnrnpa3	G	T	2: 75,492,040 (GRCm39)	R52L	probably damaging	Het
Ing3	T	C	6: 21,952,170 (GRCm39)	M48T	probably benign	Het
Kmt2a	A	G	9: 44,741,356 (GRCm39)		probably benign	Het
Megf8	G	A	7: 25,053,383 (GRCm39)		probably null	Het
Pou6f1	G	A	15: 100,485,717 (GRCm39)	Q106*	probably null	Het
Ror2	T	C	13: 53,267,110 (GRCm39)	M442V	probably benign	Het
Rspo1	G	A	4: 124,885,190 (GRCm39)	R22Q	probably benign	Het
Sec1	A	G	7: 45,328,315 (GRCm39)	V244A	probably damaging	Het
Serac1	A	G	17: 6,115,212 (GRCm39)		probably benign	Het
Sgcz	A	G	8: 38,012,596 (GRCm39)		probably benign	Het
Slc16a7	A	T	10: 125,063,939 (GRCm39)	V466D	probably benign	Het
Tbl1xr1	T	A	3: 22,243,949 (GRCm39)	D74E	probably benign	Het
Ube3b	G	T	5: 114,546,278 (GRCm39)		probably null	Het
Ugt2b37	A	G	5: 87,402,080 (GRCm39)	S184P	probably benign	Het

Other mutations in Pex3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01153:Pex3	APN	10	13,428,597 (GRCm39)	splice site	probably null
IGL02367:Pex3	APN	10	13,400,643 (GRCm39)	missense	probably benign	0.39
IGL02538:Pex3	APN	10	13,411,344 (GRCm39)	missense	possibly damaging	0.94
IGL02645:Pex3	APN	10	13,422,173 (GRCm39)	missense	possibly damaging	0.92
IGL03096:Pex3	APN	10	13,410,407 (GRCm39)	splice site	probably benign
R0494:Pex3	UTSW	10	13,403,532 (GRCm39)	missense	probably damaging	1.00
R0945:Pex3	UTSW	10	13,418,420 (GRCm39)	missense	probably benign	0.43
R4574:Pex3	UTSW	10	13,411,315 (GRCm39)	nonsense	probably null
R6407:Pex3	UTSW	10	13,422,112 (GRCm39)	missense	probably damaging	1.00
R7549:Pex3	UTSW	10	13,418,414 (GRCm39)	missense	probably benign
R7751:Pex3	UTSW	10	13,403,550 (GRCm39)	missense	possibly damaging	0.67
R8033:Pex3	UTSW	10	13,407,024 (GRCm39)	nonsense	probably null
R9413:Pex3	UTSW	10	13,410,454 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCCCAGTGTGAAAAGGCTGATAATG -3'
(R):5'- ACTCTGTTTCTGTTTGCACAGACCG -3'

Sequencing Primer
(F):5'- ggccttttttgtaagccctg -3'
(R):5'- GTTTGCACAGACCGTTCTTG -3'

Posted On

2014-07-09