Incidental Mutation 'R0436:Alx4'
ID212567
Institutional Source Beutler Lab
Gene Symbol Alx4
Ensembl Gene ENSMUSG00000040310
Gene Namearistaless-like homeobox 4
SynonymsAristaless-like 4
MMRRC Submission 038637-MU
Accession Numbers

Genbank: NM_007442; MGI: 108359

Is this an essential gene? Possibly essential (E-score: 0.628) question?
Stock #R0436 (G1)
Quality Score79
Status Validated
Chromosome2
Chromosomal Location93642384-93681339 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 93668357 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 145 (K145*)
Ref Sequence ENSEMBL: ENSMUSP00000106885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042078] [ENSMUST00000111254] [ENSMUST00000184931]
Predicted Effect probably null
Transcript: ENSMUST00000042078
AA Change: K145*
SMART Domains Protein: ENSMUSP00000047962
Gene: ENSMUSG00000040310
AA Change: K145*

DomainStartEndE-ValueType
low complexity region 91 108 N/A INTRINSIC
HOX 202 264 1.11e-28 SMART
low complexity region 302 319 N/A INTRINSIC
Pfam:OAR 375 393 1.5e-12 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000111254
AA Change: K145*
SMART Domains Protein: ENSMUSP00000106885
Gene: ENSMUSG00000040310
AA Change: K145*

DomainStartEndE-ValueType
low complexity region 91 108 N/A INTRINSIC
HOX 202 264 1.11e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184931
SMART Domains Protein: ENSMUSP00000138956
Gene: ENSMUSG00000027198

DomainStartEndE-ValueType
transmembrane domain 24 46 N/A INTRINSIC
Pfam:Exostosin 100 380 1.4e-57 PFAM
Pfam:Glyco_transf_64 456 559 9.5e-31 PFAM
Meta Mutation Damage Score 0.656 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 93.4%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a paired-like homeodomain transcription factor expressed in the mesenchyme of developing bones, limbs, hair, teeth, and mammary tissue. Mutations in this gene cause parietal foramina 2 (PFM2); an autosomal dominant disease characterized by deficient ossification of the parietal bones. Mutations in this gene also cause a form of frontonasal dysplasia with alopecia and hypogonadism; suggesting a role for this gene in craniofacial development, mesenchymal-epithelial communication, and hair follicle development. Deletion of a segment of chromosome 11 containing this gene, del(11)(p11p12), causes Potocki-Shaffer syndrome (PSS); a syndrome characterized by craniofacial anomalies, mental retardation, multiple exostoses, and genital abnormalities in males. In mouse, this gene has been shown to use dual translation initiation sites located 16 codons apart. [provided by RefSeq, Oct 2009]
PHENOTYPE: Depending on genetic background mutant mice may show preaxial polydactyly and other skeletal alterations, transitory alopecia, ventral body wall defects and male sterility. Homozygous mice of one allele die prenatally. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, knock-out(1) Spontaneous(1) Chemically induced(3)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933430I17Rik T C 4: 62,543,445 probably benign Het
Abcb10 C T 8: 123,971,001 G195S probably benign Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Arl8a G A 1: 135,146,980 M1I probably null Het
B230118H07Rik T C 2: 101,610,519 probably benign Het
Btbd16 G A 7: 130,786,053 S134N probably benign Het
Ccdc136 T A 6: 29,414,934 L474Q probably damaging Het
Cebpz A G 17: 78,935,650 Y192H probably benign Het
Cep95 A G 11: 106,818,685 Q109R probably null Het
Cfap54 G T 10: 93,038,975 Q520K possibly damaging Het
Cog2 C T 8: 124,548,514 probably benign Het
Cul1 A G 6: 47,523,773 N702S probably benign Het
D430041D05Rik G C 2: 104,167,950 P1836R probably damaging Het
Dmxl2 T C 9: 54,383,750 D2472G probably damaging Het
Ect2 A G 3: 27,150,095 F22L probably benign Het
Ehd4 A T 2: 120,102,341 D201E probably damaging Het
Eif4ebp3 A G 18: 36,664,301 probably null Het
Exd2 T C 12: 80,490,770 probably benign Het
Gtf2a1 A C 12: 91,568,273 probably null Het
H2-DMb1 A G 17: 34,159,656 Y256C probably damaging Het
Haus6 T C 4: 86,585,807 R527G probably benign Het
Helb C T 10: 120,094,212 probably benign Het
Hhatl C T 9: 121,788,762 A254T probably benign Het
Hk1 A T 10: 62,299,275 probably benign Het
Hmcn2 A G 2: 31,405,612 K2611R probably damaging Het
Hrc A G 7: 45,336,133 H236R possibly damaging Het
Hunk T A 16: 90,464,154 Y178N probably damaging Het
Jakmip2 G A 18: 43,558,169 Q616* probably null Het
Kcnh4 C T 11: 100,746,932 G633E probably benign Het
Msantd4 C T 9: 4,385,180 R302C probably damaging Het
Nae1 T C 8: 104,523,236 probably benign Het
Nek4 C T 14: 30,970,472 L293F probably damaging Het
Odf2l C T 3: 145,126,116 T44I possibly damaging Het
Olfr601 A G 7: 103,358,741 V151A possibly damaging Het
Otog G A 7: 46,265,936 probably benign Het
Ppp1r21 C T 17: 88,565,689 T425I possibly damaging Het
Prrc2b A G 2: 32,230,660 E2204G probably damaging Het
Prrc2c A C 1: 162,705,314 probably benign Het
Prrxl1 T C 14: 32,608,083 F81S probably damaging Het
Ptgs2 T C 1: 150,104,277 probably benign Het
Slc12a8 T A 16: 33,551,085 V197E probably damaging Het
Syne3 A G 12: 104,946,924 W593R possibly damaging Het
Tmem63a A T 1: 180,972,733 T696S probably benign Het
Tnks2 A G 19: 36,849,358 D165G possibly damaging Het
Trim43a T C 9: 88,588,187 W349R probably damaging Het
Unc45b T C 11: 82,929,567 probably benign Het
Vmn1r4 T A 6: 56,956,962 N150K probably damaging Het
Wdfy4 C A 14: 33,083,812 probably benign Het
Wdr77 T A 3: 105,960,026 D63E probably damaging Het
Zan T C 5: 137,464,902 T672A unknown Het
Zdhhc17 A T 10: 110,981,990 probably null Het
Other mutations in Alx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01872:Alx4 APN 2 93677473 missense probably benign 0.10
goofy UTSW 2 93675369 missense probably damaging 1.00
R0367:Alx4 UTSW 2 93668608 missense probably damaging 1.00
R0864:Alx4 UTSW 2 93642855 missense probably damaging 1.00
R1913:Alx4 UTSW 2 93675387 missense probably damaging 1.00
R3712:Alx4 UTSW 2 93642789 missense possibly damaging 0.87
R4619:Alx4 UTSW 2 93642761 missense probably damaging 1.00
R5018:Alx4 UTSW 2 93677419 missense probably damaging 0.99
R5227:Alx4 UTSW 2 93677380 missense probably damaging 1.00
R6505:Alx4 UTSW 2 93668559 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGCAAGAAAGCCACCAAGGTC -3'
(R):5'- TCCCGTGCATACACATCAGGGTAG -3'

Sequencing Primer
(F):5'- ggatgatgccacagaggg -3'
(R):5'- CATACACATCAGGGTAGTGTGTC -3'
Posted On2014-07-09