Incidental Mutation 'R0497:L3mbtl3'
ID212573
Institutional Source Beutler Lab
Gene Symbol L3mbtl3
Ensembl Gene ENSMUSG00000039089
Gene NameL3MBTL3 histone methyl-lysine binding protein
SynonymsMBT-1
MMRRC Submission 038693-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0497 (G1)
Quality Score60
Status Validated
Chromosome10
Chromosomal Location26274468-26375971 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 26282874 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000133479 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040219] [ENSMUST00000105519] [ENSMUST00000174766]
Predicted Effect probably benign
Transcript: ENSMUST00000040219
SMART Domains Protein: ENSMUSP00000037619
Gene: ENSMUSG00000039089

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105519
SMART Domains Protein: ENSMUSP00000101158
Gene: ENSMUSG00000039089

DomainStartEndE-ValueType
low complexity region 129 141 N/A INTRINSIC
low complexity region 179 189 N/A INTRINSIC
MBT 207 307 3.75e-48 SMART
MBT 315 414 3.67e-42 SMART
MBT 423 518 7.5e-48 SMART
low complexity region 579 590 N/A INTRINSIC
low complexity region 637 745 N/A INTRINSIC
SAM 783 850 2.49e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174766
SMART Domains Protein: ENSMUSP00000133479
Gene: ENSMUSG00000039089

DomainStartEndE-ValueType
low complexity region 154 166 N/A INTRINSIC
low complexity region 204 214 N/A INTRINSIC
MBT 232 332 3.75e-48 SMART
MBT 340 439 3.67e-42 SMART
MBT 448 543 7.5e-48 SMART
low complexity region 604 615 N/A INTRINSIC
low complexity region 662 770 N/A INTRINSIC
SAM 808 875 2.49e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218585
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the malignant brain tumor (MBT) family of chromatin interacting transcriptional repressors. Members of this family function as methyl-lysine readers, which recognize methylated lysine residues on histone protein tails, and are associated with the repression of gene expression. The encoded protein may regulate hematopoiesis. Homozygous deletion of this gene has been observed in human patients with medulloblastoma. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a null mutation die between E17.5 ? 19.5 due to disturbed erythropoiesis which result in anemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530053A07Rik T A 7: 28,147,465 C1158S probably damaging Het
Aatk A C 11: 120,018,780 V110G probably damaging Het
Adcy6 A C 15: 98,597,725 probably null Het
Adm A G 7: 110,629,121 T170A probably benign Het
Afap1l2 G T 19: 56,930,209 N171K probably benign Het
Aph1b G T 9: 66,790,618 S112* probably null Het
Arhgap23 A G 11: 97,452,163 S424G probably damaging Het
Asah2 T A 19: 32,054,631 N46I probably benign Het
Braf G A 6: 39,640,549 probably benign Het
Brd2 C T 17: 34,114,360 R47Q probably damaging Het
C2cd5 A G 6: 143,012,093 V972A probably benign Het
Car9 T A 4: 43,511,881 L300H probably damaging Het
Chmp3 T C 6: 71,552,411 S20P probably damaging Het
Chp1 A G 2: 119,571,782 N79S possibly damaging Het
Cnot2 A T 10: 116,498,355 I335N probably damaging Het
Cntnap4 T C 8: 112,570,151 V6A probably benign Het
Ctcf T A 8: 105,675,040 probably benign Het
Dennd1b A G 1: 139,039,986 probably benign Het
Dirc2 A T 16: 35,735,604 V162D probably benign Het
Dnmbp A G 19: 43,856,640 probably benign Het
Eef2 T C 10: 81,181,586 F782L probably benign Het
Eogt T A 6: 97,135,233 Y153F probably benign Het
Fam81a G T 9: 70,096,119 Q237K possibly damaging Het
Fat2 T A 11: 55,283,402 T2162S probably benign Het
Gas6 T C 8: 13,470,387 I434V possibly damaging Het
Gm42417 A T 1: 36,532,167 L77Q probably damaging Het
Grik3 A T 4: 125,623,510 N49Y possibly damaging Het
Gucy2e A T 11: 69,224,159 V974E probably damaging Het
Helz2 A G 2: 181,229,656 V2721A probably damaging Het
Klhl6 GT G 16: 19,956,966 probably null Het
Krt73 A G 15: 101,802,230 L23P probably damaging Het
Lrrc15 A T 16: 30,272,892 V543E probably damaging Het
Med13 G A 11: 86,276,983 probably benign Het
Med25 T C 7: 44,892,100 D60G probably damaging Het
Mgam T A 6: 40,664,892 Y560N probably damaging Het
Mlkl A G 8: 111,327,873 Y211H probably damaging Het
Msl2 A G 9: 101,101,294 N289S probably benign Het
Nwd2 G T 5: 63,806,343 W1090L probably damaging Het
Olfr1281 A G 2: 111,328,830 D137G probably benign Het
Omt2b T C 9: 78,328,231 probably benign Het
Pald1 A G 10: 61,341,315 L652P probably damaging Het
Pard3b T A 1: 62,440,008 probably null Het
Prdm15 G A 16: 97,794,334 T1098I possibly damaging Het
Rock2 A G 12: 16,954,953 T436A probably benign Het
Sema4c A T 1: 36,549,608 D812E probably benign Het
Sla A T 15: 66,792,249 I91K probably benign Het
Slc22a16 T G 10: 40,584,967 M255R probably damaging Het
Smg8 C T 11: 87,086,084 D224N possibly damaging Het
Spdef A T 17: 27,718,058 D190E probably benign Het
Taok1 A G 11: 77,573,804 I152T probably damaging Het
Tmem220 A G 11: 67,025,922 D36G probably damaging Het
Tmem235 A C 11: 117,864,351 I210L probably benign Het
Tmem266 C T 9: 55,380,884 probably null Het
Tmprss12 A G 15: 100,281,039 probably benign Het
Trim32 G A 4: 65,613,254 R16Q probably damaging Het
Usp38 T A 8: 80,984,424 probably benign Het
Usp44 C T 10: 93,846,806 P373S possibly damaging Het
Vmn1r209 G T 13: 22,805,948 Q191K probably damaging Het
Vmn1r70 T C 7: 10,634,026 I147T probably benign Het
Vmn2r107 T A 17: 20,375,132 I649N probably damaging Het
Vmn2r12 A T 5: 109,091,889 Y269* probably null Het
Zan C T 5: 137,412,676 probably benign Het
Zfp616 G T 11: 74,083,480 V192L probably benign Het
Zfp644 A T 5: 106,638,333 V116D probably damaging Het
Zgrf1 T C 3: 127,584,650 probably benign Het
Zhx3 A T 2: 160,779,994 L751* probably null Het
Znfx1 T A 2: 167,055,411 Q531L probably benign Het
Other mutations in L3mbtl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:L3mbtl3 APN 10 26313846 critical splice donor site probably null
IGL01357:L3mbtl3 APN 10 26330185 missense unknown
IGL01712:L3mbtl3 APN 10 26276235 missense probably damaging 0.96
IGL01759:L3mbtl3 APN 10 26331900 missense unknown
IGL01928:L3mbtl3 APN 10 26330245 missense unknown
IGL01955:L3mbtl3 APN 10 26318438 missense unknown
IGL02674:L3mbtl3 APN 10 26282813 missense unknown
IGL02731:L3mbtl3 APN 10 26344176 critical splice donor site probably null
IGL03188:L3mbtl3 APN 10 26342617 missense unknown
IGL03252:L3mbtl3 APN 10 26331812 splice site probably benign
IGL03298:L3mbtl3 APN 10 26282798 missense unknown
IGL03400:L3mbtl3 APN 10 26315526 missense unknown
R0121:L3mbtl3 UTSW 10 26313870 missense unknown
R0468:L3mbtl3 UTSW 10 26327732 missense unknown
R0586:L3mbtl3 UTSW 10 26327834 missense unknown
R0633:L3mbtl3 UTSW 10 26302685 missense unknown
R0679:L3mbtl3 UTSW 10 26313933 nonsense probably null
R1302:L3mbtl3 UTSW 10 26327769 missense unknown
R2128:L3mbtl3 UTSW 10 26313868 missense unknown
R2267:L3mbtl3 UTSW 10 26331857 nonsense probably null
R3121:L3mbtl3 UTSW 10 26344221 intron probably benign
R3410:L3mbtl3 UTSW 10 26339299 missense unknown
R4237:L3mbtl3 UTSW 10 26340948 missense unknown
R4257:L3mbtl3 UTSW 10 26280122 missense unknown
R4308:L3mbtl3 UTSW 10 26282792 missense unknown
R4359:L3mbtl3 UTSW 10 26327741 missense unknown
R4407:L3mbtl3 UTSW 10 26313884 missense unknown
R4613:L3mbtl3 UTSW 10 26282795 missense unknown
R4663:L3mbtl3 UTSW 10 26337817 missense unknown
R4843:L3mbtl3 UTSW 10 26331879 missense unknown
R4886:L3mbtl3 UTSW 10 26292770 missense unknown
R5158:L3mbtl3 UTSW 10 26303688 missense unknown
R5247:L3mbtl3 UTSW 10 26327808 missense unknown
R5580:L3mbtl3 UTSW 10 26303706 missense unknown
R5966:L3mbtl3 UTSW 10 26331864 missense unknown
R6218:L3mbtl3 UTSW 10 26292747 missense unknown
R6508:L3mbtl3 UTSW 10 26318427 missense unknown
R6563:L3mbtl3 UTSW 10 26302863 intron probably null
R6709:L3mbtl3 UTSW 10 26282797 missense unknown
R6927:L3mbtl3 UTSW 10 26292669 nonsense probably null
R6984:L3mbtl3 UTSW 10 26282855 missense unknown
R7010:L3mbtl3 UTSW 10 26282861 critical splice acceptor site probably null
R7229:L3mbtl3 UTSW 10 26292662 missense unknown
R7231:L3mbtl3 UTSW 10 26339282 missense unknown
R7296:L3mbtl3 UTSW 10 26282830 missense unknown
R7363:L3mbtl3 UTSW 10 26340952 missense unknown
Predicted Primers PCR Primer
(F):5'- TGTCTGCATCCTGAGCAACACC -3'
(R):5'- GCCATGTCTTCCTGAGTGGTTCATC -3'

Sequencing Primer
(F):5'- GAGAGTCAAACCCATTGTCCTATG -3'
(R):5'- TCCTGAGTGGTTCATCTTCATAG -3'
Posted On2014-07-09