Incidental Mutation 'R1917:Myo3a'
ID212581
Institutional Source Beutler Lab
Gene Symbol Myo3a
Ensembl Gene ENSMUSG00000025716
Gene Namemyosin IIIA
Synonyms9030416P08Rik
MMRRC Submission 039935-MU
Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1917 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location22227503-22618252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 22291922 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 242 (H242Q)
Ref Sequence ENSEMBL: ENSMUSP00000046329 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000153002]
Predicted Effect probably damaging
Transcript: ENSMUST00000044749
AA Change: H242Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: H242Q

DomainStartEndE-ValueType
S_TKc 29 295 1.62e-91 SMART
MYSc 340 1061 2.07e-252 SMART
IQ 1061 1083 2.88e1 SMART
IQ 1088 1110 9.48e-3 SMART
low complexity region 1153 1169 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
low complexity region 1496 1505 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142435
Predicted Effect probably damaging
Transcript: ENSMUST00000153002
AA Change: H234Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120573
Gene: ENSMUSG00000025716
AA Change: H234Q

DomainStartEndE-ValueType
S_TKc 21 287 1.62e-91 SMART
MYSc 332 753 3.06e-35 SMART
Meta Mutation Damage Score 0.446 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 93.6%
Validation Efficiency 100% (83/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931440F15Rik A G 11: 29,824,039 S473P probably benign Het
Abca8a A G 11: 110,091,515 probably benign Het
Adgre5 A G 8: 83,729,109 V190A probably damaging Het
Akap6 A G 12: 53,104,612 N1153S probably benign Het
Aldh1a7 G A 19: 20,727,455 H20Y probably benign Het
B430306N03Rik A G 17: 48,324,148 E278G probably benign Het
Cacna1b C A 2: 24,616,879 R72L probably null Het
Cc2d2a C G 5: 43,706,222 S675R probably damaging Het
Ccdc88b T A 19: 6,849,226 E1040D probably damaging Het
Cmtm7 A G 9: 114,763,364 V55A probably damaging Het
Coq4 A C 2: 29,789,926 T77P probably damaging Het
Cyp2j11 C A 4: 96,339,974 W136L probably damaging Het
Dctn2 T A 10: 127,275,049 Y86* probably null Het
Ddx56 A G 11: 6,263,937 probably null Het
Dopey2 T C 16: 93,716,262 S30P probably damaging Het
Ep400 T C 5: 110,703,575 K1347R unknown Het
Fat3 T A 9: 15,997,057 T2550S possibly damaging Het
Fcrla G T 1: 170,927,526 C5* probably null Het
Fermt1 T A 2: 132,922,842 D365V probably damaging Het
Fhod3 A G 18: 24,989,965 probably benign Het
Fhod3 A G 18: 25,085,601 D807G probably benign Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Gart T C 16: 91,628,149 Y662C probably damaging Het
Gda A T 19: 21,397,640 probably benign Het
Gk A G X: 85,760,580 I85T probably damaging Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm14548 C T 7: 3,897,638 V38M probably damaging Het
Gm3476 A G 14: 6,118,358 L255P possibly damaging Het
Gm9966 T C 7: 95,958,477 C2R unknown Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gtf2h4 G A 17: 35,670,198 L246F possibly damaging Het
Hao1 A T 2: 134,523,060 S216T probably benign Het
Hnrnpr C A 4: 136,332,488 S301* probably null Het
Hsd3b2 A G 3: 98,712,026 I201T probably benign Het
Jade2 T C 11: 51,818,538 E548G possibly damaging Het
Katnbl1 T C 2: 112,409,179 I241T probably benign Het
Keap1 G T 9: 21,233,806 Q299K probably benign Het
Kif1a T C 1: 93,019,031 I1650V possibly damaging Het
Lrba G A 3: 86,664,501 G275R probably damaging Het
Map3k9 C A 12: 81,780,790 E29* probably null Het
Mat1a G A 14: 41,121,437 V307I probably damaging Het
Mcm2 A T 6: 88,891,803 M324K possibly damaging Het
Metap1d T C 2: 71,511,527 V155A probably damaging Het
Mtbp A G 15: 55,564,677 probably benign Het
Myh14 T C 7: 44,657,925 T231A probably benign Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Myo15b T A 11: 115,882,254 I1837K possibly damaging Het
Nxn A G 11: 76,261,672 probably benign Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Pak3 C A X: 143,791,302 A553E possibly damaging Het
Pdia2 T A 17: 26,198,105 T122S possibly damaging Het
Plod2 A G 9: 92,581,257 T132A probably benign Het
Ptprz1 T A 6: 23,035,040 probably benign Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Recql4 A T 15: 76,703,837 Y1142* probably null Het
Rnf216 A G 5: 142,992,806 V859A probably benign Het
Scnm1 G T 3: 95,130,273 P161T possibly damaging Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Serpinf1 A G 11: 75,411,007 I274T possibly damaging Het
Slc28a1 T C 7: 81,169,586 F641L probably benign Het
Slc8a2 A G 7: 16,152,920 I657V probably benign Het
Smchd1 A G 17: 71,407,237 I877T possibly damaging Het
Spata31 T C 13: 64,920,865 Y276H possibly damaging Het
Spire2 A G 8: 123,363,071 D447G probably benign Het
Stk3 G A 15: 35,073,217 T119I probably damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Sult2a5 T C 7: 13,670,684 F282S probably damaging Het
Syk A T 13: 52,622,708 D248V probably damaging Het
Thoc6 C T 17: 23,669,390 probably benign Het
Tll2 T A 19: 41,128,497 D293V possibly damaging Het
Umodl1 G A 17: 30,984,043 V457M probably damaging Het
Usp19 T A 9: 108,499,325 C689* probably null Het
Usp24 T G 4: 106,410,286 V1955G probably damaging Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn2r69 C T 7: 85,411,683 C231Y probably damaging Het
Wdr73 C T 7: 80,893,333 D176N probably benign Het
Wnt7b T A 15: 85,559,080 I41F probably damaging Het
Zfhx3 T C 8: 108,956,248 S3440P unknown Het
Zfp52 T G 17: 21,560,164 N91K probably benign Het
Zfp930 C A 8: 69,228,705 Q350K probably benign Het
Zfp949 T C 9: 88,570,062 S562P probably damaging Het
Other mutations in Myo3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Myo3a APN 2 22332473 missense probably benign 0.42
IGL01307:Myo3a APN 2 22558289 missense probably damaging 1.00
IGL01413:Myo3a APN 2 22297600 missense probably benign 0.25
IGL01655:Myo3a APN 2 22423326 missense probably damaging 1.00
IGL01767:Myo3a APN 2 22423222 missense probably damaging 0.96
IGL01803:Myo3a APN 2 22241115 missense probably damaging 1.00
IGL01969:Myo3a APN 2 22297688 missense probably benign 0.03
IGL02043:Myo3a APN 2 22399965 missense probably benign 0.01
IGL02124:Myo3a APN 2 22577526 missense probably benign 0.01
IGL02174:Myo3a APN 2 22332393 missense probably benign 0.04
IGL02649:Myo3a APN 2 22323607 missense probably benign
IGL02976:Myo3a APN 2 22542452 nonsense probably null
IGL03328:Myo3a APN 2 22578198 missense probably benign 0.02
IGL03376:Myo3a APN 2 22600074 splice site probably benign
A5278:Myo3a UTSW 2 22323653 missense probably benign 0.27
PIT4445001:Myo3a UTSW 2 22542415 missense possibly damaging 0.64
R0008:Myo3a UTSW 2 22579741 missense probably damaging 0.99
R0099:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0212:Myo3a UTSW 2 22291848 missense probably damaging 1.00
R0281:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0282:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0492:Myo3a UTSW 2 22323636 missense possibly damaging 0.46
R0498:Myo3a UTSW 2 22577429 missense possibly damaging 0.74
R0594:Myo3a UTSW 2 22544332 splice site probably benign
R0609:Myo3a UTSW 2 22333513 missense probably benign 0.29
R0609:Myo3a UTSW 2 22396299 missense possibly damaging 0.95
R0827:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R0968:Myo3a UTSW 2 22558289 missense probably damaging 1.00
R1157:Myo3a UTSW 2 22542414 critical splice acceptor site probably null
R1301:Myo3a UTSW 2 22267095 splice site probably benign
R1352:Myo3a UTSW 2 22323675 critical splice donor site probably null
R1443:Myo3a UTSW 2 22282626 missense probably damaging 0.99
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1517:Myo3a UTSW 2 22282634 missense probably damaging 0.99
R1565:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1712:Myo3a UTSW 2 22564992 missense probably damaging 1.00
R1722:Myo3a UTSW 2 22399827 missense probably benign 0.03
R1822:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1823:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1824:Myo3a UTSW 2 22396243 missense probably benign
R1837:Myo3a UTSW 2 22577592 missense possibly damaging 0.76
R1867:Myo3a UTSW 2 22399846 missense probably benign 0.00
R1920:Myo3a UTSW 2 22564996 missense probably benign 0.02
R1937:Myo3a UTSW 2 22396315 missense probably damaging 1.00
R1954:Myo3a UTSW 2 22241226 missense probably damaging 1.00
R1988:Myo3a UTSW 2 22578128 missense possibly damaging 0.86
R2091:Myo3a UTSW 2 22333677 missense probably damaging 0.99
R2115:Myo3a UTSW 2 22245531 missense probably damaging 1.00
R2125:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2126:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2216:Myo3a UTSW 2 22577771 missense probably benign 0.00
R2413:Myo3a UTSW 2 22577912 missense probably benign 0.00
R2964:Myo3a UTSW 2 22340256 missense possibly damaging 0.90
R3196:Myo3a UTSW 2 22399868 missense possibly damaging 0.86
R3837:Myo3a UTSW 2 22565109 splice site probably benign
R3905:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R3926:Myo3a UTSW 2 22565041 missense probably damaging 0.99
R4014:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4015:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4017:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4043:Myo3a UTSW 2 22333539 splice site probably benign
R4044:Myo3a UTSW 2 22577700 missense probably damaging 0.99
R4057:Myo3a UTSW 2 22266160 missense probably benign 0.01
R4192:Myo3a UTSW 2 22407377 missense probably damaging 1.00
R4282:Myo3a UTSW 2 22340278 missense probably benign 0.14
R4321:Myo3a UTSW 2 22267155 missense probably damaging 1.00
R4393:Myo3a UTSW 2 22577854 missense probably damaging 0.99
R4398:Myo3a UTSW 2 22577842 missense probably benign
R4446:Myo3a UTSW 2 22600137 missense probably damaging 1.00
R4685:Myo3a UTSW 2 22407422 missense probably damaging 1.00
R5032:Myo3a UTSW 2 22282602 missense probably damaging 1.00
R5096:Myo3a UTSW 2 22574242 missense probably benign 0.16
R5183:Myo3a UTSW 2 22578158 missense probably benign 0.05
R5458:Myo3a UTSW 2 22245550 missense probably damaging 1.00
R5502:Myo3a UTSW 2 22558369 missense probably damaging 1.00
R5522:Myo3a UTSW 2 22574341 missense probably damaging 1.00
R6462:Myo3a UTSW 2 22558411 missense probably damaging 1.00
R6479:Myo3a UTSW 2 22577865 missense probably benign 0.00
R6513:Myo3a UTSW 2 22407332 missense probably damaging 1.00
R6520:Myo3a UTSW 2 22399926 missense possibly damaging 0.90
R6602:Myo3a UTSW 2 22577787 missense probably damaging 0.96
R6671:Myo3a UTSW 2 22294522 missense probably damaging 1.00
R6743:Myo3a UTSW 2 22361664 missense probably benign 0.24
R6865:Myo3a UTSW 2 22574301 missense probably benign 0.00
R6961:Myo3a UTSW 2 22245558 missense probably benign 0.00
R7001:Myo3a UTSW 2 22332377 missense probably benign 0.04
R7215:Myo3a UTSW 2 22245567 missense possibly damaging 0.78
R7301:Myo3a UTSW 2 22544466 critical splice donor site probably null
R7318:Myo3a UTSW 2 22558320 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCAATCCTGCTGTGGTATTGTC -3'
(R):5'- TCAGATGGCCAGTTGAAGG -3'

Sequencing Primer
(F):5'- GCTCTCAACTTTATCAGGTTAAACAC -3'
(R):5'- TGAAGCAGGCAGATCATCTTC -3'
Posted On2014-07-14