Incidental Mutation 'R1918:Strn4'
ID212705
Institutional Source Beutler Lab
Gene Symbol Strn4
Ensembl Gene ENSMUSG00000030374
Gene Namestriatin, calmodulin binding protein 4
SynonymsZIN, zinedin
MMRRC Submission 039936-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.675) question?
Stock #R1918 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location16815889-16840931 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16833921 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 507 (Y507N)
Ref Sequence ENSEMBL: ENSMUSP00000104135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019220] [ENSMUST00000108495] [ENSMUST00000185011]
Predicted Effect probably damaging
Transcript: ENSMUST00000019220
AA Change: Y514N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000019220
Gene: ENSMUSG00000030374
AA Change: Y514N

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 21 60 N/A INTRINSIC
Pfam:Striatin 64 193 1.2e-44 PFAM
low complexity region 217 236 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
WD40 434 473 5.72e-9 SMART
WD40 487 526 6.53e-4 SMART
WD40 540 579 6.99e-13 SMART
WD40 584 626 2.38e1 SMART
WD40 629 672 3.55e1 SMART
WD40 675 714 5.34e-9 SMART
WD40 717 760 1.58e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108495
AA Change: Y507N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104135
Gene: ENSMUSG00000030374
AA Change: Y507N

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 21 60 N/A INTRINSIC
Pfam:Striatin 64 197 1.4e-45 PFAM
low complexity region 217 236 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
low complexity region 409 422 N/A INTRINSIC
WD40 427 466 5.72e-9 SMART
WD40 480 519 6.53e-4 SMART
WD40 533 572 6.99e-13 SMART
WD40 577 619 2.38e1 SMART
WD40 622 665 3.55e1 SMART
WD40 668 707 5.34e-9 SMART
WD40 710 753 1.58e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123510
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127835
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131721
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183680
Predicted Effect probably benign
Transcript: ENSMUST00000184694
Predicted Effect probably benign
Transcript: ENSMUST00000184708
Predicted Effect probably benign
Transcript: ENSMUST00000185011
SMART Domains Protein: ENSMUSP00000139290
Gene: ENSMUSG00000030374

DomainStartEndE-ValueType
low complexity region 33 51 N/A INTRINSIC
Meta Mutation Damage Score 0.472 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency 97% (113/116)
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110035E14Rik T C 1: 9,601,627 F15S probably damaging Het
4930432E11Rik T G 7: 29,574,089 noncoding transcript Het
4930435E12Rik A G 16: 38,828,088 Y220H possibly damaging Het
4931440F15Rik A G 11: 29,824,039 S473P probably benign Het
A2m T C 6: 121,644,936 S314P probably benign Het
Abcc9 T A 6: 142,697,682 I47F probably damaging Het
Abcd2 C T 15: 91,191,481 R43H probably benign Het
Adgre5 A G 8: 83,729,109 V190A probably damaging Het
Aen C T 7: 78,906,029 H242Y possibly damaging Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap10 T C 8: 77,259,079 I698V probably benign Het
Arpp21 C T 9: 112,119,178 probably benign Het
Atp10a T C 7: 58,827,935 I1294T possibly damaging Het
Atp13a2 T C 4: 140,996,371 Y337H possibly damaging Het
BC147527 T C 13: 120,308,222 L26P probably damaging Het
Bsn C T 9: 108,107,573 G3094D unknown Het
Cadm2 G A 16: 66,747,384 probably benign Het
Cadps T C 14: 12,546,372 M495V probably damaging Het
Cass4 A G 2: 172,427,339 H447R possibly damaging Het
Ccdc124 C A 8: 70,868,944 R108L probably benign Het
Ccdc141 C T 2: 77,014,703 R1340Q probably benign Het
Ccdc148 T G 2: 58,982,899 R299S probably damaging Het
Ccdc36 T A 9: 108,412,985 H140L probably benign Het
Cd300lg A G 11: 102,054,110 E382G probably damaging Het
Cd36 A T 5: 17,797,036 C322* probably null Het
Celsr2 C T 3: 108,398,650 G2046D probably benign Het
Clasrp C T 7: 19,585,263 W492* probably null Het
Cmtr1 T C 17: 29,679,009 V154A possibly damaging Het
Ctnnb1 C T 9: 120,951,034 P128S possibly damaging Het
Cyp11a1 A G 9: 58,026,757 I496V probably damaging Het
Disp2 G A 2: 118,791,927 V1047I probably benign Het
Eps8l2 T C 7: 141,361,724 V636A probably damaging Het
Fars2 T C 13: 36,204,546 L6P probably damaging Het
Fnip1 C T 11: 54,480,684 T177I probably damaging Het
Fut8 G T 12: 77,332,218 R31L probably benign Het
G6pd2 T C 5: 61,810,321 F480L probably benign Het
Glipr1l2 T A 10: 112,092,645 C148* probably null Het
Gm10142 G A 10: 77,715,987 V61M probably benign Het
Gm12169 A G 11: 46,528,531 D58G possibly damaging Het
Gm5134 T A 10: 75,976,346 M145K possibly damaging Het
Gm853 A T 4: 130,211,393 V328D probably benign Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpc2 T C 5: 138,278,379 T162A probably benign Het
Gtf2h4 G A 17: 35,670,198 L246F possibly damaging Het
Hal C T 10: 93,496,607 P294S probably damaging Het
Hectd3 C T 4: 117,000,343 A573V possibly damaging Het
Hephl1 T A 9: 15,076,818 I665F probably benign Het
Herc1 T C 9: 66,476,126 probably null Het
Hif1an A G 19: 44,571,112 probably null Het
Il12rb1 T A 8: 70,813,680 M223K probably benign Het
Ilf3 C T 9: 21,393,714 T201M probably damaging Het
Inpp5f T C 7: 128,663,969 probably benign Het
Jcad T C 18: 4,674,292 Y685H probably damaging Het
Kcnj1 C A 9: 32,396,738 Q153K probably benign Het
Kctd18 A C 1: 57,959,220 H73Q probably damaging Het
Klhl36 T A 8: 119,876,724 W573R probably damaging Het
Lepr A G 4: 101,772,836 T583A probably benign Het
Ltbp4 G A 7: 27,337,569 probably benign Het
Mapt A T 11: 104,298,499 E114D probably benign Het
Mib1 T A 18: 10,740,972 probably null Het
Mthfd1 G T 12: 76,314,976 A119S probably damaging Het
Mylk4 A T 13: 32,724,853 D90E probably benign Het
Nceh1 T G 3: 27,183,175 L33R probably damaging Het
Nfat5 T C 8: 107,366,236 I91T probably damaging Het
Nxn A G 11: 76,261,672 probably benign Het
Oasl1 G A 5: 114,923,469 A20T possibly damaging Het
Olfr1262 T C 2: 90,002,574 F56S probably benign Het
Olfr141 C T 2: 86,806,827 M57I probably damaging Het
Olfr1428 A G 19: 12,109,507 V13A probably benign Het
Olfr1447 A G 19: 12,900,851 *310Q probably null Het
Olfr164 A T 16: 19,286,302 M147K probably benign Het
Olfr791 T A 10: 129,527,049 V274D probably damaging Het
Pepd T C 7: 34,971,676 V215A probably benign Het
Pfkl A T 10: 78,001,426 N104K probably damaging Het
Phf24 T C 4: 42,938,165 probably benign Het
Pink1 T C 4: 138,314,020 N530S probably benign Het
Pou3f2 T C 4: 22,487,119 D338G probably damaging Het
Ppp1r13b A G 12: 111,834,810 V480A probably damaging Het
Ptgfrn A T 3: 101,056,307 I663N probably benign Het
Rad54b A C 4: 11,601,693 N416T probably damaging Het
Rasef A G 4: 73,744,114 S200P possibly damaging Het
Rbm33 T A 5: 28,387,917 I605N probably damaging Het
Rps19bp1 T C 15: 80,264,079 T31A probably benign Het
Ryr2 T A 13: 11,556,698 T4885S possibly damaging Het
Serpinb6b A G 13: 32,978,240 I222V probably benign Het
Sik3 C G 9: 46,221,089 H1276Q probably benign Het
Skor2 T C 18: 76,859,356 S258P unknown Het
Slc22a29 C T 19: 8,217,759 probably null Het
Slc8a3 A T 12: 81,314,844 F400L probably damaging Het
Slc9a8 T C 2: 167,424,214 I37T possibly damaging Het
Smchd1 A G 17: 71,407,237 I877T possibly damaging Het
Spag5 A G 11: 78,304,176 N103S probably benign Het
Sptbn1 A T 11: 30,142,414 F450L probably damaging Het
Stxbp5 C A 10: 9,812,298 V420F possibly damaging Het
Syt17 G T 7: 118,433,985 L267I possibly damaging Het
Tdo2 T A 3: 81,958,940 R339W probably damaging Het
Ttn A G 2: 76,741,401 S26383P probably damaging Het
Ttn G T 2: 76,808,524 T13938K probably damaging Het
Tulp2 A G 7: 45,517,941 N188D possibly damaging Het
Ube3c C T 5: 29,587,317 R37C probably damaging Het
Uggt2 G T 14: 119,008,055 probably benign Het
Umodl1 G A 17: 30,984,043 V457M probably damaging Het
Usp17la C T 7: 104,860,746 T186I probably benign Het
Vmn1r226 T C 17: 20,687,580 S25P probably damaging Het
Vmn1r235 T A 17: 21,262,397 I328K possibly damaging Het
Vmn2r50 A T 7: 10,047,683 S378R probably benign Het
Vwa2 C T 19: 56,908,934 T557I probably benign Het
Wdr60 A C 12: 116,232,601 S509A probably damaging Het
Yes1 G T 5: 32,684,735 Q534H probably benign Het
Zbtb25 A T 12: 76,349,301 Y382* probably null Het
Zc3h3 G A 15: 75,777,118 P722S probably damaging Het
Zfp36l2 T C 17: 84,186,736 T158A probably damaging Het
Zfp536 T C 7: 37,480,199 T994A probably damaging Het
Zfp592 C T 7: 81,037,420 Q824* probably null Het
Zfp629 C A 7: 127,612,000 K212N probably damaging Het
Zfp930 C A 8: 69,228,705 Q350K probably benign Het
Other mutations in Strn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00776:Strn4 APN 7 16830452 missense probably damaging 1.00
IGL01153:Strn4 APN 7 16837921 missense probably damaging 1.00
IGL01748:Strn4 APN 7 16838302 missense probably damaging 1.00
IGL03227:Strn4 APN 7 16837714 missense possibly damaging 0.79
PIT4260001:Strn4 UTSW 7 16822509 missense probably damaging 1.00
R0948:Strn4 UTSW 7 16837713 nonsense probably null
R1876:Strn4 UTSW 7 16838282 missense probably damaging 1.00
R2015:Strn4 UTSW 7 16833028 missense possibly damaging 0.85
R2250:Strn4 UTSW 7 16826466 missense probably damaging 1.00
R3435:Strn4 UTSW 7 16837633 missense possibly damaging 0.86
R3686:Strn4 UTSW 7 16822581 missense probably damaging 1.00
R3688:Strn4 UTSW 7 16822581 missense probably damaging 1.00
R3887:Strn4 UTSW 7 16822998 unclassified probably benign
R4613:Strn4 UTSW 7 16824163 missense possibly damaging 0.50
R4730:Strn4 UTSW 7 16828794 missense possibly damaging 0.59
R5590:Strn4 UTSW 7 16833874 critical splice acceptor site probably null
R5924:Strn4 UTSW 7 16838321 missense probably damaging 1.00
R6327:Strn4 UTSW 7 16816459 missense probably benign 0.00
R6759:Strn4 UTSW 7 16823053 missense probably damaging 1.00
R6866:Strn4 UTSW 7 16828785 missense probably damaging 0.97
R6976:Strn4 UTSW 7 16830354 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- GCCAAATTCCTCATGGCATC -3'
(R):5'- CACTGTCCCTCAAATGCAGC -3'

Sequencing Primer
(F):5'- CAGCCTAGTCTACAGAGTGAGTTC -3'
(R):5'- TCAAATGCAGCCCAACTCTC -3'
Posted On2014-07-14