Incidental Mutation 'R1920:Myo3a'
ID212907
Institutional Source Beutler Lab
Gene Symbol Myo3a
Ensembl Gene ENSMUSG00000025716
Gene Namemyosin IIIA
Synonyms9030416P08Rik
MMRRC Submission 039938-MU
Accession Numbers

Genbank: NM_148413; MGI: 2183924

Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock #R1920 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location22227503-22618252 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 22564996 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 71 (Y71C)
Ref Sequence ENSEMBL: ENSMUSP00000116185 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044749] [ENSMUST00000138863]
Predicted Effect probably benign
Transcript: ENSMUST00000044749
AA Change: Y1009C

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000046329
Gene: ENSMUSG00000025716
AA Change: Y1009C

DomainStartEndE-ValueType
S_TKc 29 295 1.62e-91 SMART
MYSc 340 1061 2.07e-252 SMART
IQ 1061 1083 2.88e1 SMART
IQ 1088 1110 9.48e-3 SMART
low complexity region 1153 1169 N/A INTRINSIC
low complexity region 1359 1369 N/A INTRINSIC
low complexity region 1496 1505 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138863
AA Change: Y71C

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000116185
Gene: ENSMUSG00000025716
AA Change: Y71C

DomainStartEndE-ValueType
Pfam:Myosin_head 1 110 1.7e-28 PFAM
IQ 123 145 2.88e1 SMART
IQ 150 172 9.48e-3 SMART
low complexity region 215 231 N/A INTRINSIC
low complexity region 421 431 N/A INTRINSIC
low complexity region 558 567 N/A INTRINSIC
Meta Mutation Damage Score 0.02 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.4%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the myosin superfamily. Myosins are actin-dependent motor proteins and are categorized into conventional myosins (class II) and unconventional myosins (classes I and III through XV) based on their variable C-terminal cargo-binding domains. Class III myosins, such as this one, have a kinase domain N-terminal to the conserved N-terminal motor domains and are expressed in photoreceptors. The protein encoded by this gene plays an important role in hearing in humans. Three different recessive, loss of function mutations in the encoded protein have been shown to cause nonsyndromic progressive hearing loss. Expression of this gene is highly restricted, with the strongest expression in retina and cochlea. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired hearing and cochlear hair cell degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 184,033,631 V77A probably benign Het
Actl7a G A 4: 56,744,135 V221M probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgef10 C T 8: 14,956,987 probably benign Het
Asgr2 T C 11: 70,098,297 L86P possibly damaging Het
Atp12a A G 14: 56,386,851 R919G probably benign Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
B3gnt5 T G 16: 19,769,544 L171R probably benign Het
Bbof1 T A 12: 84,411,085 N41K possibly damaging Het
Bdp1 A T 13: 100,098,589 W166R probably benign Het
Bean1 A T 8: 104,211,110 H107L possibly damaging Het
Brd4 T C 17: 32,198,086 probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cep78 G A 19: 15,974,351 probably benign Het
Cfap70 C T 14: 20,394,952 A1087T probably damaging Het
Cideb A G 14: 55,755,243 V72A probably benign Het
Cpz T C 5: 35,517,668 E79G probably damaging Het
Crybg1 A G 10: 43,997,548 L1188P probably damaging Het
Cuzd1 G A 7: 131,309,696 P518L probably benign Het
Cyp2j5 A T 4: 96,663,254 N77K probably damaging Het
Cyp4f39 T G 17: 32,483,291 F254C probably benign Het
Dkk1 C A 19: 30,547,331 V225L probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dll3 T C 7: 28,298,923 T206A probably benign Het
Dnhd1 T C 7: 105,713,407 C3766R probably benign Het
Dock9 G T 14: 121,583,380 S1534Y probably damaging Het
Dst T C 1: 34,161,029 V96A probably damaging Het
F2r A G 13: 95,604,190 F279S probably damaging Het
Fam208b A T 13: 3,576,612 Y1113N possibly damaging Het
Farp1 C A 14: 121,255,496 N503K probably benign Het
Fbxw2 G A 2: 34,822,764 T95I probably damaging Het
Fis1 A G 5: 136,965,607 T50A probably benign Het
Frzb T G 2: 80,446,428 E138A probably damaging Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Fyco1 C T 9: 123,830,413 D233N probably damaging Het
Gm14548 G C 7: 3,897,872 P20R probably damaging Het
Gmpr A G 13: 45,514,521 probably benign Het
Hc C T 2: 35,029,395 probably benign Het
Hnrnpa1 T C 15: 103,242,272 M186T possibly damaging Het
Kl A G 5: 150,982,667 K501E probably benign Het
Klhl42 A G 6: 147,107,929 N422S probably damaging Het
Kmt2d C G 15: 98,855,590 K127N probably damaging Het
Kmt2d T A 15: 98,855,591 K127M probably damaging Het
Krt39 T A 11: 99,514,635 T480S probably benign Het
Lims2 T A 18: 31,955,342 C198* probably null Het
Mctp1 A G 13: 76,384,610 N26D possibly damaging Het
Mdm4 A G 1: 133,003,800 S168P probably benign Het
Nlrp9c T A 7: 26,384,894 D420V probably damaging Het
Ntf3 A T 6: 126,102,522 I7N possibly damaging Het
Olfr1113 G A 2: 87,213,377 G162S probably benign Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr272 G T 4: 52,910,849 T315K probably benign Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Papln C A 12: 83,789,254 Y1222* probably null Het
Pgm3 T G 9: 86,558,478 I387L possibly damaging Het
Pkd1 C A 17: 24,595,157 P4167Q probably damaging Het
Plcb4 T A 2: 136,013,027 V1174E probably damaging Het
Polr1b A G 2: 129,101,111 N9D probably benign Het
Prkaa2 G A 4: 105,036,753 Q456* probably null Het
Ptch2 G T 4: 117,108,661 V425L probably benign Het
Ptprh A T 7: 4,549,395 S957T probably benign Het
Riok1 A G 13: 38,057,201 D444G probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rrp36 C T 17: 46,672,745 R47Q possibly damaging Het
Sec24c T C 14: 20,686,887 S304P probably damaging Het
Serpinb6b A T 13: 32,975,008 D64V possibly damaging Het
Serpinb9b A T 13: 33,039,548 probably null Het
Six6 T A 12: 72,941,764 I237N probably damaging Het
Slc25a36 A T 9: 97,093,082 M127K probably benign Het
Slc2a10 A G 2: 165,514,630 D70G probably damaging Het
Slc2a3 T A 6: 122,736,741 I171F probably damaging Het
Smc4 A G 3: 69,033,068 T1087A probably damaging Het
Spg21 A G 9: 65,484,497 Y242C probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Stx2 G A 5: 128,988,839 T251M probably damaging Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Tbc1d31 G A 15: 57,912,364 R17H probably damaging Het
Tbl3 G A 17: 24,704,503 T284I probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tgoln1 T C 6: 72,616,101 E132G probably benign Het
Timeless T C 10: 128,241,714 I221T probably damaging Het
Tmem176b C T 6: 48,838,204 A52T possibly damaging Het
Tmem192 C T 8: 64,965,583 L207F probably damaging Het
Trank1 T C 9: 111,347,928 probably null Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubb5 T C 17: 35,835,298 Y340C probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vcan T C 13: 89,693,015 E1470G probably damaging Het
Vmn1r200 T A 13: 22,395,493 N146K probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r61 T C 7: 42,300,286 I710T possibly damaging Het
Wipf1 T A 2: 73,440,155 K61N probably benign Het
Zfp112 T C 7: 24,125,237 V210A probably benign Het
Zfp612 G A 8: 110,088,463 V101M probably benign Het
Zfp637 A G 6: 117,845,720 R270G probably damaging Het
Zfp652 A G 11: 95,764,025 E418G possibly damaging Het
Zfp97 A G 17: 17,145,003 I255V probably benign Het
Other mutations in Myo3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Myo3a APN 2 22332473 missense probably benign 0.42
IGL01307:Myo3a APN 2 22558289 missense probably damaging 1.00
IGL01413:Myo3a APN 2 22297600 missense probably benign 0.25
IGL01655:Myo3a APN 2 22423326 missense probably damaging 1.00
IGL01767:Myo3a APN 2 22423222 missense probably damaging 0.96
IGL01803:Myo3a APN 2 22241115 missense probably damaging 1.00
IGL01969:Myo3a APN 2 22297688 missense probably benign 0.03
IGL02043:Myo3a APN 2 22399965 missense probably benign 0.01
IGL02124:Myo3a APN 2 22577526 missense probably benign 0.01
IGL02174:Myo3a APN 2 22332393 missense probably benign 0.04
IGL02649:Myo3a APN 2 22323607 missense probably benign
IGL02976:Myo3a APN 2 22542452 nonsense probably null
IGL03328:Myo3a APN 2 22578198 missense probably benign 0.02
IGL03376:Myo3a APN 2 22600074 splice site probably benign
A5278:Myo3a UTSW 2 22323653 missense probably benign 0.27
R0008:Myo3a UTSW 2 22579741 missense probably damaging 0.99
R0099:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0103:Myo3a UTSW 2 22544322 splice site probably benign
R0212:Myo3a UTSW 2 22291848 missense probably damaging 1.00
R0281:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0282:Myo3a UTSW 2 22245598 missense probably benign 0.03
R0492:Myo3a UTSW 2 22323636 missense possibly damaging 0.46
R0498:Myo3a UTSW 2 22577429 missense possibly damaging 0.74
R0594:Myo3a UTSW 2 22544332 splice site probably benign
R0609:Myo3a UTSW 2 22333513 missense probably benign 0.29
R0609:Myo3a UTSW 2 22396299 missense possibly damaging 0.95
R0827:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R0968:Myo3a UTSW 2 22558289 missense probably damaging 1.00
R1157:Myo3a UTSW 2 22542414 critical splice acceptor site probably null
R1301:Myo3a UTSW 2 22267095 splice site probably benign
R1352:Myo3a UTSW 2 22323675 critical splice donor site probably null
R1443:Myo3a UTSW 2 22282626 missense probably damaging 0.99
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1465:Myo3a UTSW 2 22577927 missense probably benign 0.00
R1517:Myo3a UTSW 2 22282634 missense probably damaging 0.99
R1565:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1712:Myo3a UTSW 2 22564992 missense probably damaging 1.00
R1722:Myo3a UTSW 2 22399827 missense probably benign 0.03
R1822:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1823:Myo3a UTSW 2 22340280 missense probably damaging 1.00
R1824:Myo3a UTSW 2 22396243 missense probably benign
R1837:Myo3a UTSW 2 22577592 missense possibly damaging 0.76
R1867:Myo3a UTSW 2 22399846 missense probably benign 0.00
R1917:Myo3a UTSW 2 22291922 missense probably damaging 1.00
R1937:Myo3a UTSW 2 22396315 missense probably damaging 1.00
R1954:Myo3a UTSW 2 22241226 missense probably damaging 1.00
R1988:Myo3a UTSW 2 22578128 missense possibly damaging 0.86
R2091:Myo3a UTSW 2 22333677 missense probably damaging 0.99
R2115:Myo3a UTSW 2 22245531 missense probably damaging 1.00
R2125:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2126:Myo3a UTSW 2 22578174 missense probably benign 0.42
R2216:Myo3a UTSW 2 22577771 missense probably benign 0.00
R2413:Myo3a UTSW 2 22577912 missense probably benign 0.00
R2964:Myo3a UTSW 2 22340256 missense possibly damaging 0.90
R3196:Myo3a UTSW 2 22399868 missense possibly damaging 0.86
R3837:Myo3a UTSW 2 22565109 splice site probably benign
R3905:Myo3a UTSW 2 22558215 missense probably damaging 1.00
R3926:Myo3a UTSW 2 22565041 missense probably damaging 0.99
R4014:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4015:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4017:Myo3a UTSW 2 22578170 missense possibly damaging 0.76
R4043:Myo3a UTSW 2 22333539 splice site probably benign
R4044:Myo3a UTSW 2 22577700 missense probably damaging 0.99
R4057:Myo3a UTSW 2 22266160 missense probably benign 0.01
R4192:Myo3a UTSW 2 22407377 missense probably damaging 1.00
R4282:Myo3a UTSW 2 22340278 missense probably benign 0.14
R4321:Myo3a UTSW 2 22267155 missense probably damaging 1.00
R4393:Myo3a UTSW 2 22577854 missense probably damaging 0.99
R4398:Myo3a UTSW 2 22577842 missense probably benign
R4446:Myo3a UTSW 2 22600137 missense probably damaging 1.00
R4685:Myo3a UTSW 2 22407422 missense probably damaging 1.00
R5032:Myo3a UTSW 2 22282602 missense probably damaging 1.00
R5096:Myo3a UTSW 2 22574242 missense probably benign 0.16
R5183:Myo3a UTSW 2 22578158 missense probably benign 0.05
R5458:Myo3a UTSW 2 22245550 missense probably damaging 1.00
R5502:Myo3a UTSW 2 22558369 missense probably damaging 1.00
R5522:Myo3a UTSW 2 22574341 missense probably damaging 1.00
R6462:Myo3a UTSW 2 22558411 missense probably damaging 1.00
R6479:Myo3a UTSW 2 22577865 missense probably benign 0.00
R6513:Myo3a UTSW 2 22407332 missense probably damaging 1.00
R6520:Myo3a UTSW 2 22399926 missense possibly damaging 0.90
R6602:Myo3a UTSW 2 22577787 missense probably damaging 0.96
R6671:Myo3a UTSW 2 22294522 missense probably damaging 1.00
R6743:Myo3a UTSW 2 22361664 missense probably benign 0.24
R6865:Myo3a UTSW 2 22574301 missense probably benign 0.00
R6961:Myo3a UTSW 2 22245558 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTACAGAAGACTCTTGGTTTGTATC -3'
(R):5'- TATTTACTGCCAGTGCCATTGG -3'

Sequencing Primer
(F):5'- GAAGACTCTTGGTTTGTATCTATCTC -3'
(R):5'- GCAGTGTCATTCCTAGGCAAC -3'
Posted On2014-07-14