Incidental Mutation 'R1920:Stx2'
ID212932
Institutional Source Beutler Lab
Gene Symbol Stx2
Ensembl Gene ENSMUSG00000029428
Gene Namesyntaxin 2
Synonymsrepro34, G1-536-1, Syn-2, Epim
MMRRC Submission 039938-MU
Accession Numbers

Ncbi RefSeq: NM_007941.2; MGI:108059

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1920 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location128984557-129008574 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128988839 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 251 (T251M)
Ref Sequence ENSEMBL: ENSMUSP00000098247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031378] [ENSMUST00000100680] [ENSMUST00000149877] [ENSMUST00000195906]
Predicted Effect probably damaging
Transcript: ENSMUST00000031378
AA Change: T251M

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000031378
Gene: ENSMUSG00000029428
AA Change: T251M

DomainStartEndE-ValueType
SynN 25 146 1.33e-40 SMART
low complexity region 159 170 N/A INTRINSIC
low complexity region 175 185 N/A INTRINSIC
t_SNARE 187 254 1.74e-19 SMART
transmembrane domain 266 288 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100680
AA Change: T251M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000098247
Gene: ENSMUSG00000029428
AA Change: T251M

DomainStartEndE-ValueType
SynN 25 146 1.33e-40 SMART
low complexity region 159 170 N/A INTRINSIC
low complexity region 175 185 N/A INTRINSIC
t_SNARE 187 254 1.74e-19 SMART
transmembrane domain 265 287 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128448
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141492
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144846
Predicted Effect probably benign
Transcript: ENSMUST00000149877
SMART Domains Protein: ENSMUSP00000118220
Gene: ENSMUSG00000029428

DomainStartEndE-ValueType
Pfam:Syntaxin 1 85 1.3e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151712
Predicted Effect probably benign
Transcript: ENSMUST00000195906
Meta Mutation Damage Score 0.0288 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.4%
Validation Efficiency 98% (101/103)
MGI Phenotype Strain: 3526405
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the syntaxin/epimorphin family of proteins. The syntaxins are a large protein family implicated in the targeting and fusion of intracellular transport vesicles. The product of this gene regulates epithelial-mesenchymal interactions and epithelial cell morphogenesis and activation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display male infertility associated with abnormal testicular development and impaired spermatogenesis, increased intestinal growth due to enhanced crypt cell proliferation and crypt fission, and decreased susceptibility to induced colitis. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(4) Gene trapped(5) Chemically induced(1)

Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700056E22Rik A G 1: 184,033,631 V77A probably benign Het
Actl7a G A 4: 56,744,135 V221M probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Arhgef10 C T 8: 14,956,987 probably benign Het
Asgr2 T C 11: 70,098,297 L86P possibly damaging Het
Atp12a A G 14: 56,386,851 R919G probably benign Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
B3gnt5 T G 16: 19,769,544 L171R probably benign Het
Bbof1 T A 12: 84,411,085 N41K possibly damaging Het
Bdp1 A T 13: 100,098,589 W166R probably benign Het
Bean1 A T 8: 104,211,110 H107L possibly damaging Het
Brd4 T C 17: 32,198,086 probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cep78 G A 19: 15,974,351 probably benign Het
Cfap70 C T 14: 20,394,952 A1087T probably damaging Het
Cideb A G 14: 55,755,243 V72A probably benign Het
Cpz T C 5: 35,517,668 E79G probably damaging Het
Crybg1 A G 10: 43,997,548 L1188P probably damaging Het
Cuzd1 G A 7: 131,309,696 P518L probably benign Het
Cyp2j5 A T 4: 96,663,254 N77K probably damaging Het
Cyp4f39 T G 17: 32,483,291 F254C probably benign Het
Dkk1 C A 19: 30,547,331 V225L probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dll3 T C 7: 28,298,923 T206A probably benign Het
Dnhd1 T C 7: 105,713,407 C3766R probably benign Het
Dock9 G T 14: 121,583,380 S1534Y probably damaging Het
Dst T C 1: 34,161,029 V96A probably damaging Het
F2r A G 13: 95,604,190 F279S probably damaging Het
Fam208b A T 13: 3,576,612 Y1113N possibly damaging Het
Farp1 C A 14: 121,255,496 N503K probably benign Het
Fbxw2 G A 2: 34,822,764 T95I probably damaging Het
Fis1 A G 5: 136,965,607 T50A probably benign Het
Frzb T G 2: 80,446,428 E138A probably damaging Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Fyco1 C T 9: 123,830,413 D233N probably damaging Het
Gm14548 G C 7: 3,897,872 P20R probably damaging Het
Gmpr A G 13: 45,514,521 probably benign Het
Hc C T 2: 35,029,395 probably benign Het
Hnrnpa1 T C 15: 103,242,272 M186T possibly damaging Het
Kl A G 5: 150,982,667 K501E probably benign Het
Klhl42 A G 6: 147,107,929 N422S probably damaging Het
Kmt2d C G 15: 98,855,590 K127N probably damaging Het
Kmt2d T A 15: 98,855,591 K127M probably damaging Het
Krt39 T A 11: 99,514,635 T480S probably benign Het
Lims2 T A 18: 31,955,342 C198* probably null Het
Mctp1 A G 13: 76,384,610 N26D possibly damaging Het
Mdm4 A G 1: 133,003,800 S168P probably benign Het
Myo3a A G 2: 22,564,996 Y71C probably benign Het
Nlrp9c T A 7: 26,384,894 D420V probably damaging Het
Ntf3 A T 6: 126,102,522 I7N possibly damaging Het
Olfr1113 G A 2: 87,213,377 G162S probably benign Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr272 G T 4: 52,910,849 T315K probably benign Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Papln C A 12: 83,789,254 Y1222* probably null Het
Pgm3 T G 9: 86,558,478 I387L possibly damaging Het
Pkd1 C A 17: 24,595,157 P4167Q probably damaging Het
Plcb4 T A 2: 136,013,027 V1174E probably damaging Het
Polr1b A G 2: 129,101,111 N9D probably benign Het
Prkaa2 G A 4: 105,036,753 Q456* probably null Het
Ptch2 G T 4: 117,108,661 V425L probably benign Het
Ptprh A T 7: 4,549,395 S957T probably benign Het
Riok1 A G 13: 38,057,201 D444G probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rrp36 C T 17: 46,672,745 R47Q possibly damaging Het
Sec24c T C 14: 20,686,887 S304P probably damaging Het
Serpinb6b A T 13: 32,975,008 D64V possibly damaging Het
Serpinb9b A T 13: 33,039,548 probably null Het
Six6 T A 12: 72,941,764 I237N probably damaging Het
Slc25a36 A T 9: 97,093,082 M127K probably benign Het
Slc2a10 A G 2: 165,514,630 D70G probably damaging Het
Slc2a3 T A 6: 122,736,741 I171F probably damaging Het
Smc4 A G 3: 69,033,068 T1087A probably damaging Het
Spg21 A G 9: 65,484,497 Y242C probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Tbc1d31 G A 15: 57,912,364 R17H probably damaging Het
Tbl3 G A 17: 24,704,503 T284I probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tgoln1 T C 6: 72,616,101 E132G probably benign Het
Timeless T C 10: 128,241,714 I221T probably damaging Het
Tmem176b C T 6: 48,838,204 A52T possibly damaging Het
Tmem192 C T 8: 64,965,583 L207F probably damaging Het
Trank1 T C 9: 111,347,928 probably null Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubb5 T C 17: 35,835,298 Y340C probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vcan T C 13: 89,693,015 E1470G probably damaging Het
Vmn1r200 T A 13: 22,395,493 N146K probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r61 T C 7: 42,300,286 I710T possibly damaging Het
Wipf1 T A 2: 73,440,155 K61N probably benign Het
Zfp112 T C 7: 24,125,237 V210A probably benign Het
Zfp612 G A 8: 110,088,463 V101M probably benign Het
Zfp637 A G 6: 117,845,720 R270G probably damaging Het
Zfp652 A G 11: 95,764,025 E418G possibly damaging Het
Zfp97 A G 17: 17,145,003 I255V probably benign Het
Other mutations in Stx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:Stx2 APN 5 128990978 missense probably benign 0.01
IGL01951:Stx2 APN 5 128992265 missense probably damaging 1.00
IGL02348:Stx2 APN 5 128988830 missense probably damaging 1.00
IGL02902:Stx2 APN 5 128992221 missense probably damaging 1.00
R0050:Stx2 UTSW 5 128999508 critical splice donor site probably null
R0050:Stx2 UTSW 5 128999508 critical splice donor site probably null
R0277:Stx2 UTSW 5 128988903 missense probably benign 0.00
R0323:Stx2 UTSW 5 128988903 missense probably benign 0.00
R0419:Stx2 UTSW 5 128993577 splice site probably benign
R0843:Stx2 UTSW 5 128999548 missense probably damaging 1.00
R1346:Stx2 UTSW 5 128988788 unclassified probably benign
R1631:Stx2 UTSW 5 128992225 missense probably damaging 1.00
R5350:Stx2 UTSW 5 128991091 missense probably damaging 1.00
R6877:Stx2 UTSW 5 128987820 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTTCAGGGAAAACCCAAATCC -3'
(R):5'- TGAGGGAGCCTGTCTCTATC -3'

Sequencing Primer
(F):5'- GGGAAAACCCAAATCCTATCAGTTTG -3'
(R):5'- ATCCCTCTCATGCTGGGC -3'
Posted On2014-07-14