Incidental Mutation 'R1921:Neu2'
ID213014
Institutional Source Beutler Lab
Gene Symbol Neu2
Ensembl Gene ENSMUSG00000079434
Gene Nameneuraminidase 2
SynonymsMSS, MTS, MBS, cystolic sialidase, brain sialidase
MMRRC Submission 039939-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R1921 (G1)
Quality Score154
Status Not validated
Chromosome1
Chromosomal Location87509889-87597845 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87597301 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 336 (E336G)
Ref Sequence ENSEMBL: ENSMUSP00000131409 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070898] [ENSMUST00000163606] [ENSMUST00000164128] [ENSMUST00000165109] [ENSMUST00000166055] [ENSMUST00000166259] [ENSMUST00000172222]
Predicted Effect probably benign
Transcript: ENSMUST00000070898
AA Change: E322G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000065439
Gene: ENSMUSG00000079434
AA Change: E322G

DomainStartEndE-ValueType
Pfam:BNR_2 32 345 4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163606
SMART Domains Protein: ENSMUSP00000127777
Gene: ENSMUSG00000079434

DomainStartEndE-ValueType
PDB:2F27|B 15 90 1e-31 PDB
SCOP:d1eur__ 19 90 1e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164128
AA Change: E328G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000127913
Gene: ENSMUSG00000079434
AA Change: E328G

DomainStartEndE-ValueType
Pfam:BNR_2 38 351 1.3e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165109
AA Change: E322G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126509
Gene: ENSMUSG00000079434
AA Change: E322G

DomainStartEndE-ValueType
Pfam:BNR_2 32 345 4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166055
SMART Domains Protein: ENSMUSP00000132099
Gene: ENSMUSG00000079434

DomainStartEndE-ValueType
Pfam:BNR_2 32 110 8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166259
AA Change: E322G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132513
Gene: ENSMUSG00000079434
AA Change: E322G

DomainStartEndE-ValueType
Pfam:BNR_2 32 345 4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172222
AA Change: E336G

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000131409
Gene: ENSMUSG00000079434
AA Change: E336G

DomainStartEndE-ValueType
Pfam:BNR_2 46 359 1.2e-43 PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 94.9%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to a family of glycohydrolytic enzymes which remove sialic acid residues from glycoproteins and glycolipids. Expression studies in COS7 cells confirmed that this gene encodes a functional sialidase. Its cytosolic localization was demonstrated by cell fractionation experiments. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 86 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9030624J02Rik A G 7: 118,833,748 N568S probably damaging Het
A2m C A 6: 121,654,612 L623M probably benign Het
Abhd2 T C 7: 79,348,356 I212T possibly damaging Het
Adam7 A C 14: 68,512,625 S449A possibly damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Aox3 T C 1: 58,180,651 Y1137H probably damaging Het
Atp11b T C 3: 35,834,325 Y715H probably damaging Het
Atrn A G 2: 130,995,051 Y1145C probably damaging Het
Btbd7 A G 12: 102,793,796 I631T probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Cptp C T 4: 155,866,538 R157H probably damaging Het
Dcbld1 A C 10: 52,319,651 E318D possibly damaging Het
Ddr2 G T 1: 170,004,245 P197Q probably damaging Het
Dlg5 T C 14: 24,176,571 Y421C probably damaging Het
Dlgap2 A G 8: 14,843,624 K980E probably benign Het
Drc7 T C 8: 95,056,016 V3A unknown Het
Dst T C 1: 34,161,029 V96A probably damaging Het
Ect2l T C 10: 18,143,004 D548G possibly damaging Het
Efcab10 A T 12: 33,398,435 Y89F probably benign Het
Eif1ad CGAGGAGGAGGAGGAGGAGG CGAGGAGGAGGAGGAGG 19: 5,370,058 probably benign Het
Entpd6 A G 2: 150,758,812 T147A probably damaging Het
Fbxl5 T A 5: 43,765,490 E189D probably benign Het
Fer1l6 T A 15: 58,625,231 S1217T probably damaging Het
Frem2 A T 3: 53,653,495 V1197D possibly damaging Het
Fsip2 T A 2: 82,980,783 L2482* probably null Het
Fsip2 A T 2: 82,986,820 D4299V probably benign Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Hoxb1 T A 11: 96,366,112 Y96N probably damaging Het
Ibsp A G 5: 104,310,212 E205G probably damaging Het
Ibtk A G 9: 85,703,082 S1170P probably benign Het
Igfn1 A G 1: 135,966,063 probably null Het
Iqsec1 A G 6: 90,662,895 S954P probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Lrmda T C 14: 22,577,870 F52L probably damaging Het
Lrp2 T C 2: 69,523,287 D543G probably damaging Het
Lrrtm3 T C 10: 64,088,378 T337A probably benign Het
Marf1 C T 16: 14,128,601 D1219N possibly damaging Het
Mkln1 A G 6: 31,428,178 K118R probably benign Het
Nedd4l T C 18: 65,167,575 probably null Het
Nfasc A G 1: 132,610,805 F448S probably damaging Het
Nlrx1 C A 9: 44,254,134 E822* probably null Het
Nr5a1 T C 2: 38,694,096 Y437C probably damaging Het
Olfr1224-ps1 A G 2: 89,156,581 V198A probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Phtf1 C T 3: 103,969,122 Q13* probably null Het
Pnldc1 A G 17: 12,888,928 L525P possibly damaging Het
Ppl T A 16: 5,106,124 D162V possibly damaging Het
Prkdc T A 16: 15,714,215 S1448T possibly damaging Het
Ptgdr A G 14: 44,853,281 I340T probably benign Het
Recql T C 6: 142,365,589 I458M probably benign Het
Rrbp1 A T 2: 143,988,291 V652E probably benign Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Ryr1 A G 7: 29,054,944 M3523T probably damaging Het
S100a16 T C 3: 90,542,396 L62P probably damaging Het
Samd11 T C 4: 156,248,709 E364G probably damaging Het
Satb1 C A 17: 51,742,115 G603* probably null Het
Shroom3 T A 5: 92,962,365 probably null Het
Slc25a15 A G 8: 22,395,761 S3P probably benign Het
Socs2 A T 10: 95,413,038 L71* probably null Het
Sptbn1 T C 11: 30,104,469 E2208G probably damaging Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Susd1 T A 4: 59,412,191 T121S probably benign Het
Svs3b A T 2: 164,255,928 S158T probably benign Het
Synpo C T 18: 60,603,589 M428I probably benign Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Taar4 A G 10: 23,961,341 D283G probably damaging Het
Tango6 T A 8: 106,688,794 D82E probably benign Het
Tcof1 T C 18: 60,838,855 T127A possibly damaging Het
Tle3 G A 9: 61,411,340 probably null Het
Tmem45a A G 16: 56,822,302 F169L probably benign Het
Trp53rkb T A 2: 166,795,823 V233E probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Tubgcp3 A T 8: 12,621,932 L770* probably null Het
Tut1 G A 19: 8,966,102 G851D probably benign Het
Ubr1 G A 2: 120,930,968 T576I probably benign Het
Vmn1r125 T A 7: 21,272,605 Y143N probably damaging Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Vmn2r95 T A 17: 18,424,313 N70K probably benign Het
Wdr59 A T 8: 111,486,950 L311* probably null Het
Wnt2 A G 6: 18,030,253 L12P unknown Het
Xrn1 T C 9: 95,999,497 I700T probably benign Het
Ypel1 A G 16: 17,082,579 H98R probably benign Het
Zfp219 T C 14: 52,008,234 T434A probably benign Het
Zik1 A C 7: 10,490,016 C385G probably damaging Het
Other mutations in Neu2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02476:Neu2 APN 1 87596952 missense probably damaging 1.00
IGL03143:Neu2 APN 1 87596976 nonsense probably null
R0083:Neu2 UTSW 1 87597262 missense probably damaging 1.00
R0097:Neu2 UTSW 1 87597466 missense probably benign
R0097:Neu2 UTSW 1 87597466 missense probably benign
R1109:Neu2 UTSW 1 87596728 missense probably damaging 1.00
R2897:Neu2 UTSW 1 87595060 missense probably benign 0.01
R2898:Neu2 UTSW 1 87595060 missense probably benign 0.01
R5395:Neu2 UTSW 1 87596675 unclassified probably null
R5867:Neu2 UTSW 1 87596756 missense probably damaging 0.96
R5868:Neu2 UTSW 1 87596756 missense probably damaging 0.96
R6468:Neu2 UTSW 1 87596878 missense probably damaging 1.00
R6544:Neu2 UTSW 1 87596742 missense probably damaging 1.00
R6610:Neu2 UTSW 1 87596685 missense probably benign 0.01
R6831:Neu2 UTSW 1 87596733 missense probably damaging 1.00
R7151:Neu2 UTSW 1 87596575 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- ACAAAGTCCTAATGATGGTCTGG -3'
(R):5'- CTGGGCATCAAATACAGTGGG -3'

Sequencing Primer
(F):5'- TGGATTTCCAGGACAACCG -3'
(R):5'- ATACAGTGGGGAAAGCTTGCTTC -3'
Posted On2014-07-14