Incidental Mutation 'R0125:Eml6'
ID21307
Institutional Source Beutler Lab
Gene Symbol Eml6
Ensembl Gene ENSMUSG00000044072
Gene Nameechinoderm microtubule associated protein like 6
Synonyms
MMRRC Submission 038410-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.214) question?
Stock #R0125 (G1)
Quality Score150
Status Validated (trace)
Chromosome11
Chromosomal Location29743048-30026033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 29882088 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 194 (T194K)
Ref Sequence ENSEMBL: ENSMUSP00000051080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902]
Predicted Effect probably benign
Transcript: ENSMUST00000058902
AA Change: T194K

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: T194K

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.7%
  • 20x: 87.1%
Validation Efficiency 98% (96/98)
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930012K11Rik T C 14: 70,156,647 probably benign Het
Adam23 T C 1: 63,534,356 L261P probably benign Het
Adgra3 G A 5: 50,001,852 probably benign Het
Agtr1b A G 3: 20,315,540 F301L probably benign Het
Ahnak2 G A 12: 112,785,156 T357I probably benign Het
Aldh1a7 T C 19: 20,727,066 probably benign Het
Apoh A T 11: 108,412,073 N288I probably damaging Het
Arfgap3 A G 15: 83,343,139 V24A probably benign Het
Atp6v0a1 A G 11: 101,038,851 probably null Het
Axl A T 7: 25,786,943 M112K probably benign Het
Bnc2 A C 4: 84,292,932 I425S probably damaging Het
Cdc42bpa C T 1: 179,961,198 T30M probably damaging Het
Cebpz C A 17: 78,919,888 R1051M possibly damaging Het
Ces1d A C 8: 93,175,182 probably benign Het
Chd1l T C 3: 97,587,149 N405S probably benign Het
Chodl G T 16: 78,941,423 G93V probably damaging Het
Cpeb2 C T 5: 43,238,400 probably benign Het
Crebbp A G 16: 4,117,241 probably benign Het
Crybb3 T C 5: 113,079,809 T49A possibly damaging Het
Ctps A G 4: 120,561,525 probably benign Het
Cyp26b1 A G 6: 84,574,515 Y240H probably damaging Het
Cyp2d11 A C 15: 82,389,221 V483G probably benign Het
Dnah14 A T 1: 181,752,063 N3054Y probably damaging Het
Dspp A C 5: 104,178,039 D756A unknown Het
Dst T C 1: 34,270,903 S1553P probably damaging Het
Elp4 A G 2: 105,792,214 probably null Het
Evi5 A G 5: 107,795,772 I569T probably benign Het
Fam129b T A 2: 32,923,821 V682D probably benign Het
Fancm C T 12: 65,121,956 P1698S possibly damaging Het
Fhdc1 T C 3: 84,445,545 D791G probably benign Het
Frem1 A G 4: 83,011,951 Y253H probably damaging Het
Gpn3 A G 5: 122,381,418 Y196C probably benign Het
Hcls1 A G 16: 36,962,163 D398G probably benign Het
Hydin T C 8: 110,462,531 V1189A probably benign Het
Itgb3 G A 11: 104,643,963 D549N probably damaging Het
Itpr2 A G 6: 146,240,453 F1697S probably benign Het
Klk1b11 A G 7: 43,999,051 T161A probably benign Het
Kntc1 G A 5: 123,765,057 probably benign Het
Map3k19 A T 1: 127,823,100 F838Y probably benign Het
Map6 T A 7: 99,335,980 probably null Het
Mcrs1 A G 15: 99,244,727 probably benign Het
Mdn1 A T 4: 32,729,956 Y2766F probably damaging Het
Med23 C T 10: 24,900,788 H739Y probably damaging Het
Mmp17 T A 5: 129,594,582 D65E possibly damaging Het
Mmp9 T A 2: 164,951,257 L442Q probably damaging Het
Myo19 T C 11: 84,888,175 probably benign Het
Nedd1 A C 10: 92,691,929 S468A possibly damaging Het
Nlrp4d A C 7: 10,382,389 V152G probably damaging Het
Nxf1 T A 19: 8,762,806 D112E probably benign Het
Oas1h A T 5: 120,862,563 K79* probably null Het
Olfr494 A G 7: 108,368,369 Y293C probably damaging Het
Olfr888 A G 9: 38,109,519 T278A probably benign Het
Olfr904 T A 9: 38,464,461 L140* probably null Het
Omg T A 11: 79,502,853 I60F possibly damaging Het
Pck1 G A 2: 173,156,081 W314* probably null Het
Pla2g15 T C 8: 106,163,124 Y343H probably benign Het
Plcb3 T C 19: 6,958,908 E749G probably damaging Het
Plgrkt A G 19: 29,351,042 probably null Het
Pprc1 A G 19: 46,069,512 probably benign Het
Prkdc A T 16: 15,699,007 I1082F probably damaging Het
Rapgef6 T A 11: 54,625,875 Y172* probably null Het
Ros1 G T 10: 52,125,789 A1079D probably benign Het
Sap30 T C 8: 57,485,511 E147G probably null Het
Sell T C 1: 164,072,105 probably benign Het
Senp1 A T 15: 98,048,231 D544E probably damaging Het
Shpk G A 11: 73,214,222 probably benign Het
Slc35b1 A T 11: 95,386,527 T74S probably benign Het
Slc6a3 T A 13: 73,569,979 probably benign Het
Slf1 T C 13: 77,043,745 N990S probably benign Het
Smgc A G 15: 91,854,543 probably benign Het
Snx19 T A 9: 30,440,219 V861D probably damaging Het
Sprr2e C T 3: 92,352,978 P39S unknown Het
Sstr2 T A 11: 113,624,477 M74K probably damaging Het
St5 T C 7: 109,556,338 K402E probably benign Het
Svep1 T C 4: 58,099,937 probably benign Het
Tas2r143 A G 6: 42,400,955 I240V probably benign Het
Tbrg1 T C 9: 37,652,641 I233V probably benign Het
Tecpr1 G T 5: 144,197,899 D1055E probably damaging Het
Thap2 A T 10: 115,376,372 probably null Het
Tinagl1 A G 4: 130,166,308 Y388H probably damaging Het
Ttn T A 2: 76,755,552 Y21945F probably damaging Het
Ugt2b1 A T 5: 86,926,102 W133R probably benign Het
Usp24 C T 4: 106,397,299 P1491L possibly damaging Het
Utp15 A G 13: 98,250,882 S395P possibly damaging Het
Vav1 T A 17: 57,299,847 L254Q probably damaging Het
Vmn2r104 T C 17: 20,029,807 Y734C probably damaging Het
Vps8 T A 16: 21,470,154 V421E probably benign Het
Wisp1 T C 15: 66,917,345 S227P possibly damaging Het
Xkr7 G T 2: 153,032,426 A138S probably benign Het
Other mutations in Eml6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Eml6 APN 11 29850816 critical splice donor site probably null
IGL01407:Eml6 APN 11 29755021 nonsense probably null
IGL01434:Eml6 APN 11 29819090 missense probably damaging 1.00
IGL01578:Eml6 APN 11 29850870 missense probably benign 0.02
IGL01780:Eml6 APN 11 29805175 missense probably benign 0.17
IGL01821:Eml6 APN 11 29821699 missense probably benign 0.00
IGL01837:Eml6 APN 11 29777055 missense probably benign 0.00
IGL01904:Eml6 APN 11 29838613 nonsense probably null
IGL01972:Eml6 APN 11 29838451 missense possibly damaging 0.67
IGL02134:Eml6 APN 11 29759066 missense probably benign 0.13
IGL02192:Eml6 APN 11 29805743 missense probably benign 0.00
IGL02377:Eml6 APN 11 29777282 missense probably damaging 0.98
IGL02584:Eml6 APN 11 29749387 missense probably damaging 0.99
IGL02587:Eml6 APN 11 29784236 missense possibly damaging 0.92
IGL02810:Eml6 APN 11 29849016 missense possibly damaging 0.94
IGL02873:Eml6 APN 11 29880700 missense probably benign 0.10
IGL02880:Eml6 APN 11 29749959 missense probably benign 0.03
IGL03289:Eml6 APN 11 29795328 missense possibly damaging 0.49
IGL03301:Eml6 APN 11 29764083 missense probably benign 0.18
IGL03386:Eml6 APN 11 29749934 missense probably benign
IGL03407:Eml6 APN 11 29906330 missense probably damaging 1.00
PIT4453001:Eml6 UTSW 11 29802489 missense probably damaging 1.00
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0271:Eml6 UTSW 11 29848949 missense possibly damaging 0.48
R0304:Eml6 UTSW 11 29777441 missense probably benign 0.00
R0415:Eml6 UTSW 11 29749392 missense possibly damaging 0.84
R0449:Eml6 UTSW 11 29893213 missense probably benign 0.01
R0538:Eml6 UTSW 11 29760010 splice site probably benign
R0671:Eml6 UTSW 11 29805065 missense probably benign 0.00
R0766:Eml6 UTSW 11 29831219 splice site probably benign
R0800:Eml6 UTSW 11 29749877 missense probably benign 0.08
R0841:Eml6 UTSW 11 29777430 missense probably benign 0.41
R0879:Eml6 UTSW 11 29850816 critical splice donor site probably null
R1061:Eml6 UTSW 11 29777267 missense probably damaging 1.00
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1172:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1173:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1174:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1199:Eml6 UTSW 11 29755044 missense possibly damaging 0.93
R1311:Eml6 UTSW 11 29831088 splice site probably benign
R1312:Eml6 UTSW 11 29831219 splice site probably benign
R1355:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1370:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1457:Eml6 UTSW 11 30024459 missense probably damaging 1.00
R1486:Eml6 UTSW 11 29805114 missense possibly damaging 0.83
R1511:Eml6 UTSW 11 29818374 missense probably damaging 1.00
R1532:Eml6 UTSW 11 29792256 splice site probably null
R1642:Eml6 UTSW 11 29777001 critical splice donor site probably null
R1682:Eml6 UTSW 11 29759065 missense probably benign 0.13
R1687:Eml6 UTSW 11 29833187 missense probably damaging 1.00
R1699:Eml6 UTSW 11 29746282 nonsense probably null
R1796:Eml6 UTSW 11 29881975 missense probably benign 0.19
R1797:Eml6 UTSW 11 29882041 missense probably benign 0.09
R1837:Eml6 UTSW 11 29749802 splice site probably null
R1874:Eml6 UTSW 11 29831136 missense probably damaging 0.99
R1967:Eml6 UTSW 11 30024545 missense probably damaging 1.00
R1969:Eml6 UTSW 11 29833075 missense probably benign
R2007:Eml6 UTSW 11 29848814 critical splice donor site probably null
R2012:Eml6 UTSW 11 29831128 missense possibly damaging 0.85
R2198:Eml6 UTSW 11 29850935 missense probably benign 0.01
R2217:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2218:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2403:Eml6 UTSW 11 29802434 missense probably benign 0.05
R2520:Eml6 UTSW 11 29791993 missense probably damaging 1.00
R2937:Eml6 UTSW 11 29833049 splice site probably benign
R2938:Eml6 UTSW 11 29833049 splice site probably benign
R3085:Eml6 UTSW 11 29809332 missense probably damaging 0.96
R3236:Eml6 UTSW 11 29831097 critical splice donor site probably null
R3738:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3739:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3752:Eml6 UTSW 11 29809360 missense probably benign 0.06
R3854:Eml6 UTSW 11 29749905 missense possibly damaging 0.76
R3941:Eml6 UTSW 11 29803167 missense probably damaging 0.98
R4034:Eml6 UTSW 11 29803137 missense probably benign 0.20
R4049:Eml6 UTSW 11 29838577 missense probably damaging 1.00
R4108:Eml6 UTSW 11 29805136 missense probably damaging 0.98
R4657:Eml6 UTSW 11 29805108 missense possibly damaging 0.77
R4662:Eml6 UTSW 11 29777390 missense probably damaging 1.00
R4665:Eml6 UTSW 11 29819007 nonsense probably null
R4721:Eml6 UTSW 11 29838525 missense possibly damaging 0.95
R4729:Eml6 UTSW 11 29833204 missense probably damaging 1.00
R4766:Eml6 UTSW 11 29805757 missense probably benign 0.22
R4810:Eml6 UTSW 11 29755011 missense possibly damaging 0.92
R4831:Eml6 UTSW 11 29777052 nonsense probably null
R5035:Eml6 UTSW 11 29854187 missense probably benign 0.00
R5064:Eml6 UTSW 11 29749300 missense probably benign 0.12
R5103:Eml6 UTSW 11 29850905 missense possibly damaging 0.65
R5121:Eml6 UTSW 11 29744606 missense probably benign 0.03
R5161:Eml6 UTSW 11 30024467 missense probably damaging 0.99
R5211:Eml6 UTSW 11 29854145 missense probably benign 0.02
R5268:Eml6 UTSW 11 29803108 missense probably benign 0.15
R5390:Eml6 UTSW 11 29760096 missense probably damaging 1.00
R5529:Eml6 UTSW 11 29764126 missense probably benign 0.04
R6239:Eml6 UTSW 11 29749275 missense probably damaging 1.00
R6326:Eml6 UTSW 11 29819066 missense probably damaging 1.00
R6395:Eml6 UTSW 11 29809321 missense probably benign 0.00
R6476:Eml6 UTSW 11 29791971 critical splice donor site probably null
R6483:Eml6 UTSW 11 29749875 missense probably benign 0.00
R6701:Eml6 UTSW 11 29785748 missense probably damaging 0.98
R6753:Eml6 UTSW 11 29754987 missense probably damaging 1.00
R6809:Eml6 UTSW 11 29803161 missense probably benign 0.23
R6847:Eml6 UTSW 11 29818447 missense probably benign 0.00
R6855:Eml6 UTSW 11 29751381 splice site probably null
R7168:Eml6 UTSW 11 29838529 missense probably benign 0.01
R7175:Eml6 UTSW 11 29784231 missense probably benign 0.00
R7305:Eml6 UTSW 11 29777258 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AAACAGAGAGATGTGTGGCCTTAACC -3'
(R):5'- GACCAGTTCTATTCTGTGAACACTGGG -3'

Sequencing Primer
(F):5'- AGATGTGTGGCCTTAACCCATTC -3'
(R):5'- AATATCGTTGTGAGTTTTTCTTATGC -3'
Posted On2013-04-11