Incidental Mutation 'R1922:Dclre1c'
ID213117
Institutional Source Beutler Lab
Gene Symbol Dclre1c
Ensembl Gene ENSMUSG00000026648
Gene NameDNA cross-link repair 1C
SynonymsArtemis, Art, 9930121L06Rik
MMRRC Submission 039940-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.333) question?
Stock #R1922 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location3424131-3464130 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3440782 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 235 (F235L)
Ref Sequence ENSEMBL: ENSMUSP00000100053 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061852] [ENSMUST00000100463] [ENSMUST00000102988] [ENSMUST00000115066]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061852
AA Change: F235L

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000054300
Gene: ENSMUSG00000026648
AA Change: F235L

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 1.6e-22 PFAM
low complexity region 383 400 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
low complexity region 593 601 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100463
AA Change: F235L

PolyPhen 2 Score 0.442 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098031
Gene: ENSMUSG00000026648
AA Change: F235L

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 6.5e-23 PFAM
low complexity region 476 484 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102988
AA Change: F235L

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100053
Gene: ENSMUSG00000026648
AA Change: F235L

DomainStartEndE-ValueType
Lactamase_B 10 193 7.78e0 SMART
Pfam:DRMBL 239 345 8.8e-23 PFAM
low complexity region 383 400 N/A INTRINSIC
low complexity region 463 477 N/A INTRINSIC
internal_repeat_1 518 534 4.97e-8 PROSPERO
internal_repeat_1 525 541 4.97e-8 PROSPERO
low complexity region 545 559 N/A INTRINSIC
low complexity region 652 662 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115066
AA Change: F105L

PolyPhen 2 Score 0.877 (Sensitivity: 0.83; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110718
Gene: ENSMUSG00000026648
AA Change: F105L

DomainStartEndE-ValueType
Blast:Lactamase_B 25 70 1e-19 BLAST
Pfam:DRMBL 109 215 1.1e-22 PFAM
low complexity region 253 270 N/A INTRINSIC
low complexity region 333 347 N/A INTRINSIC
low complexity region 463 471 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000129657
SMART Domains Protein: ENSMUSP00000116883
Gene: ENSMUSG00000026648

DomainStartEndE-ValueType
Pfam:DRMBL 1 96 1.6e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132565
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146027
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.1%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the SNM1 family of nucleases and is involved in V(D)J recombination and DNA repair. This protein has single-strand-specific 5'-3' exonuclease activity; it also exhibits endonuclease activity on 5' and 3' overhangs and hairpins. The protein also functions in the regulation of the cell cycle in response to DNA damage. Homozygous knockout mice for this gene exhibit severe combined immunodeficiency with sensitivity to ionizing radiation. Mutations in this gene in humans can cause Athabascan-type severe combined immunodeficiency (SCIDA) and Omenn syndrome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous mutant mice exhibit a combined immunodeficiency phenotype. While immunoglobulin rearrangement is completely blocked in B cells, the block of V(D)J rearrangement in T cells is partial. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A C 6: 48,931,286 I407L probably benign Het
Abca12 G T 1: 71,319,924 N574K probably benign Het
Adcy9 A T 16: 4,311,657 L455H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Amy1 T A 3: 113,564,895 I163F probably damaging Het
Armc5 A G 7: 128,240,505 S332G probably benign Het
Brd4 T C 17: 32,198,086 probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Chrna1 A G 2: 73,568,232 S288P probably damaging Het
Cpe T A 8: 64,617,689 D174V probably benign Het
Ddx20 A T 3: 105,678,584 V815D probably damaging Het
Dhx9 T C 1: 153,460,274 probably null Het
Dmxl2 A C 9: 54,401,523 H1981Q probably benign Het
Doc2a A C 7: 126,851,431 D293A probably damaging Het
Eif2a C T 3: 58,548,530 R317C probably damaging Het
Fancc A G 13: 63,330,567 V318A possibly damaging Het
Fes A T 7: 80,383,986 Y172* probably null Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Glul G A 1: 153,907,324 M214I probably benign Het
Gm14496 A G 2: 182,001,004 I823V probably benign Het
Gm6665 T C 18: 31,820,265 N50S probably benign Het
Gm6729 T C 10: 86,540,918 noncoding transcript Het
Gpr21 T A 2: 37,518,338 C299S probably damaging Het
Hapln2 T A 3: 88,023,377 N196Y probably benign Het
Hsd17b12 A G 2: 94,045,392 V196A probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Kansl1 A T 11: 104,343,640 L680Q probably damaging Het
Kcna3 T C 3: 107,037,935 S505P possibly damaging Het
Klra1 A C 6: 130,372,865 N203K probably benign Het
L3mbtl2 T A 15: 81,675,621 I236N probably damaging Het
Mcm3ap C A 10: 76,507,361 P1696T probably damaging Het
Mecom T C 3: 29,957,442 D647G probably damaging Het
Mn1 A G 5: 111,418,746 D194G probably damaging Het
Muc5ac A G 7: 141,793,689 N407S probably benign Het
Mx2 C T 16: 97,560,351 R584C probably benign Het
Myo1c A G 11: 75,668,229 R597G probably benign Het
Nav3 T C 10: 109,705,606 D1932G probably benign Het
Nwd2 T A 5: 63,794,242 D205E probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Osmr T C 15: 6,844,367 E183G possibly damaging Het
Peak1 A T 9: 56,206,687 W627R probably damaging Het
Pkd1 C A 17: 24,595,157 P4167Q probably damaging Het
Plekhg4 T A 8: 105,378,385 L560Q probably damaging Het
Prg4 C T 1: 150,449,999 W1217* probably null Het
Prkdc A G 16: 15,714,266 I1465V probably benign Het
Pus1 A G 5: 110,777,639 F105S probably damaging Het
Ranbp3l T C 15: 9,057,125 S154P probably damaging Het
Rhbdl1 C T 17: 25,835,539 G211S probably damaging Het
Rnf219 T C 14: 104,479,186 K584E probably benign Het
Rrp36 C T 17: 46,672,745 R47Q possibly damaging Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Sash1 T A 10: 8,727,908 N1127Y possibly damaging Het
Setbp1 C T 18: 78,858,362 E697K possibly damaging Het
Slc27a3 A T 3: 90,386,317 V587E probably benign Het
Slc38a2 A G 15: 96,691,162 F454L possibly damaging Het
Sprn A T 7: 140,153,545 probably benign Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tbc1d1 A G 5: 64,311,221 E732G probably damaging Het
Tnfaip3 A G 10: 19,003,607 F671S possibly damaging Het
Tor1aip2 C A 1: 156,064,794 P282Q probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Ttll2 A T 17: 7,352,390 F46Y probably damaging Het
Ttn A G 2: 76,734,150 S28548P probably damaging Het
Tubb5 T C 17: 35,835,298 Y340C probably benign Het
Usp32 A T 11: 85,007,004 C1170* probably null Het
Usp54 G T 14: 20,560,904 H1281Q probably benign Het
Vgll4 C T 6: 114,921,335 G22S probably benign Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Zdhhc5 A T 2: 84,693,427 F225Y probably damaging Het
Zfp652 A G 11: 95,764,025 E418G possibly damaging Het
Other mutations in Dclre1c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00327:Dclre1c APN 2 3433784 nonsense probably null
IGL02165:Dclre1c APN 2 3450381 splice site probably benign
IGL02955:Dclre1c APN 2 3438052 missense probably damaging 1.00
IGL02961:Dclre1c APN 2 3437033 missense probably damaging 1.00
Chairy UTSW 2 3452863 missense probably damaging 1.00
kiwis UTSW 2 3436475 missense probably damaging 1.00
pee-wee UTSW 2 3437705 missense probably damaging 1.00
western_woods UTSW 2 3453169 missense possibly damaging 0.68
R0008:Dclre1c UTSW 2 3437995 missense probably damaging 0.99
R0008:Dclre1c UTSW 2 3437995 missense probably damaging 0.99
R0520:Dclre1c UTSW 2 3436475 missense probably damaging 1.00
R1994:Dclre1c UTSW 2 3437985 missense probably damaging 1.00
R4418:Dclre1c UTSW 2 3452935 missense possibly damaging 0.82
R4420:Dclre1c UTSW 2 3433745 critical splice acceptor site probably null
R4710:Dclre1c UTSW 2 3440861 critical splice donor site probably null
R5789:Dclre1c UTSW 2 3437956 missense probably damaging 1.00
R6113:Dclre1c UTSW 2 3452863 missense probably damaging 1.00
R6148:Dclre1c UTSW 2 3437705 missense probably damaging 1.00
R6519:Dclre1c UTSW 2 3429329 missense probably damaging 1.00
R6964:Dclre1c UTSW 2 3453169 missense possibly damaging 0.68
Z1088:Dclre1c UTSW 2 3438080 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- TTTTCCTAGTGACATCCTGGCAG -3'
(R):5'- TCATGGAATACAGGTACGCAG -3'

Sequencing Primer
(F):5'- GGATACTACCACTCACTGAAATAGTC -3'
(R):5'- GAGCTGCATGACTCTAACTAACAGTC -3'
Posted On2014-07-14