Incidental Mutation 'R1922:Kcna3'
ID213129
Institutional Source Beutler Lab
Gene Symbol Kcna3
Ensembl Gene ENSMUSG00000047959
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 3
SynonymsKv1.3, Mk-3, Kca1-3
MMRRC Submission 039940-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.550) question?
Stock #R1922 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107036169-107038070 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107037935 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 505 (S505P)
Ref Sequence ENSEMBL: ENSMUSP00000050680 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052718]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052718
AA Change: S505P

PolyPhen 2 Score 0.473 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000050680
Gene: ENSMUSG00000047959
AA Change: S505P

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
low complexity region 41 49 N/A INTRINSIC
BTB 57 157 6.9e-10 SMART
Pfam:Ion_trans 186 444 4.2e-54 PFAM
Pfam:Ion_trans_2 352 437 2.3e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000070085
SMART Domains Protein: ENSMUSP00000066165
Gene: ENSMUSG00000056145

DomainStartEndE-ValueType
low complexity region 79 99 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182400
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182414
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.1%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. It belongs to the delayed rectifier class, members of which allow nerve cells to efficiently repolarize following an action potential. It plays an essential role in T-cell proliferation and activation. This gene appears to be intronless and it is clustered together with KCNA2 and KCNA10 genes on chromosome 1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display no apparent immune system defects. Mice homozygous for a different knock-out allele show reduced body weight, increased basal metabolic rate, resistance to diet-induced obesity, increased insulin sensitivity, and altered peripheral glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A C 6: 48,931,286 I407L probably benign Het
Abca12 G T 1: 71,319,924 N574K probably benign Het
Adcy9 A T 16: 4,311,657 L455H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Amy1 T A 3: 113,564,895 I163F probably damaging Het
Armc5 A G 7: 128,240,505 S332G probably benign Het
Brd4 T C 17: 32,198,086 probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Chrna1 A G 2: 73,568,232 S288P probably damaging Het
Cpe T A 8: 64,617,689 D174V probably benign Het
Dclre1c T C 2: 3,440,782 F235L possibly damaging Het
Ddx20 A T 3: 105,678,584 V815D probably damaging Het
Dhx9 T C 1: 153,460,274 probably null Het
Dmxl2 A C 9: 54,401,523 H1981Q probably benign Het
Doc2a A C 7: 126,851,431 D293A probably damaging Het
Eif2a C T 3: 58,548,530 R317C probably damaging Het
Fancc A G 13: 63,330,567 V318A possibly damaging Het
Fes A T 7: 80,383,986 Y172* probably null Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Glul G A 1: 153,907,324 M214I probably benign Het
Gm14496 A G 2: 182,001,004 I823V probably benign Het
Gm6665 T C 18: 31,820,265 N50S probably benign Het
Gm6729 T C 10: 86,540,918 noncoding transcript Het
Gpr21 T A 2: 37,518,338 C299S probably damaging Het
Hapln2 T A 3: 88,023,377 N196Y probably benign Het
Hsd17b12 A G 2: 94,045,392 V196A probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Kansl1 A T 11: 104,343,640 L680Q probably damaging Het
Klra1 A C 6: 130,372,865 N203K probably benign Het
L3mbtl2 T A 15: 81,675,621 I236N probably damaging Het
Mcm3ap C A 10: 76,507,361 P1696T probably damaging Het
Mecom T C 3: 29,957,442 D647G probably damaging Het
Mn1 A G 5: 111,418,746 D194G probably damaging Het
Muc5ac A G 7: 141,793,689 N407S probably benign Het
Mx2 C T 16: 97,560,351 R584C probably benign Het
Myo1c A G 11: 75,668,229 R597G probably benign Het
Nav3 T C 10: 109,705,606 D1932G probably benign Het
Nwd2 T A 5: 63,794,242 D205E probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Osmr T C 15: 6,844,367 E183G possibly damaging Het
Peak1 A T 9: 56,206,687 W627R probably damaging Het
Pkd1 C A 17: 24,595,157 P4167Q probably damaging Het
Plekhg4 T A 8: 105,378,385 L560Q probably damaging Het
Prg4 C T 1: 150,449,999 W1217* probably null Het
Prkdc A G 16: 15,714,266 I1465V probably benign Het
Pus1 A G 5: 110,777,639 F105S probably damaging Het
Ranbp3l T C 15: 9,057,125 S154P probably damaging Het
Rhbdl1 C T 17: 25,835,539 G211S probably damaging Het
Rnf219 T C 14: 104,479,186 K584E probably benign Het
Rrp36 C T 17: 46,672,745 R47Q possibly damaging Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Sash1 T A 10: 8,727,908 N1127Y possibly damaging Het
Setbp1 C T 18: 78,858,362 E697K possibly damaging Het
Slc27a3 A T 3: 90,386,317 V587E probably benign Het
Slc38a2 A G 15: 96,691,162 F454L possibly damaging Het
Sprn A T 7: 140,153,545 probably benign Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tbc1d1 A G 5: 64,311,221 E732G probably damaging Het
Tnfaip3 A G 10: 19,003,607 F671S possibly damaging Het
Tor1aip2 C A 1: 156,064,794 P282Q probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Ttll2 A T 17: 7,352,390 F46Y probably damaging Het
Ttn A G 2: 76,734,150 S28548P probably damaging Het
Tubb5 T C 17: 35,835,298 Y340C probably benign Het
Usp32 A T 11: 85,007,004 C1170* probably null Het
Usp54 G T 14: 20,560,904 H1281Q probably benign Het
Vgll4 C T 6: 114,921,335 G22S probably benign Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Zdhhc5 A T 2: 84,693,427 F225Y probably damaging Het
Zfp652 A G 11: 95,764,025 E418G possibly damaging Het
Other mutations in Kcna3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00489:Kcna3 APN 3 107037156 missense probably benign 0.33
IGL00562:Kcna3 APN 3 107036730 missense probably damaging 1.00
IGL01106:Kcna3 APN 3 107037864 missense possibly damaging 0.89
IGL01318:Kcna3 APN 3 107037978 missense probably benign 0.03
IGL02253:Kcna3 APN 3 107037411 missense probably damaging 1.00
IGL03379:Kcna3 APN 3 107037205 missense probably benign 0.05
IGL02802:Kcna3 UTSW 3 107037053 missense probably damaging 0.99
IGL03014:Kcna3 UTSW 3 107037890 missense probably benign 0.00
R0393:Kcna3 UTSW 3 107036999 missense probably damaging 1.00
R1591:Kcna3 UTSW 3 107037029 missense probably damaging 1.00
R1950:Kcna3 UTSW 3 107037672 missense probably damaging 1.00
R3847:Kcna3 UTSW 3 107036696 missense possibly damaging 0.57
R4912:Kcna3 UTSW 3 107037891 missense probably benign
R6261:Kcna3 UTSW 3 107037950 missense possibly damaging 0.53
R6271:Kcna3 UTSW 3 107037606 missense probably damaging 1.00
R6334:Kcna3 UTSW 3 107036424 start codon destroyed probably null
R6423:Kcna3 UTSW 3 107036842 nonsense probably null
R6850:Kcna3 UTSW 3 107037159 missense probably damaging 1.00
R6901:Kcna3 UTSW 3 107036568 missense probably benign 0.00
R7193:Kcna3 UTSW 3 107036537 missense probably benign 0.02
Z1088:Kcna3 UTSW 3 107036953 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCCCAGTACATGCACGTG -3'
(R):5'- CCTGTTTCAGTATGAAGCAATAGGG -3'

Sequencing Primer
(F):5'- ACATGCACGTGGGCAGTTG -3'
(R):5'- ACTTCTTGTACTTTCCTTGATGAGTG -3'
Posted On2014-07-14