Incidental Mutation 'R1922:Fancc'
ID213171
Institutional Source Beutler Lab
Gene Symbol Fancc
Ensembl Gene ENSMUSG00000021461
Gene NameFanconi anemia, complementation group C
SynonymsFacc
MMRRC Submission 039940-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.896) question?
Stock #R1922 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location63285043-63497278 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 63330567 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 318 (V318A)
Ref Sequence ENSEMBL: ENSMUSP00000124406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073029] [ENSMUST00000099444] [ENSMUST00000161977] [ENSMUST00000163091] [ENSMUST00000220684]
Predicted Effect probably benign
Transcript: ENSMUST00000073029
AA Change: V318A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000072788
Gene: ENSMUSG00000021461
AA Change: V318A

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 558 1.8e-305 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099444
AA Change: V221A

PolyPhen 2 Score 0.770 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097043
Gene: ENSMUSG00000021461
AA Change: V221A

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 461 5.8e-243 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159056
Predicted Effect probably benign
Transcript: ENSMUST00000159152
SMART Domains Protein: ENSMUSP00000124560
Gene: ENSMUSG00000021458

DomainStartEndE-ValueType
Leuk-A4-hydro_C 1 113 4.63e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160065
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160151
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160278
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160333
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161656
Predicted Effect probably benign
Transcript: ENSMUST00000161977
AA Change: V318A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000123817
Gene: ENSMUSG00000021461
AA Change: V318A

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 558 1.8e-305 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163091
AA Change: V318A

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000124406
Gene: ENSMUSG00000021461
AA Change: V318A

DomainStartEndE-ValueType
Pfam:Fanconi_C 1 517 4.8e-238 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000220684
AA Change: V318A

PolyPhen 2 Score 0.525 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220823
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.1%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are grossly normal, but chromosome aberrations and sensitivity to DNA crosslinkers are seen. Both sexes have fewer germ cell numbers and impaired fertility. Marrow progenitors show decrease in colony forming ability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A C 6: 48,931,286 I407L probably benign Het
Abca12 G T 1: 71,319,924 N574K probably benign Het
Adcy9 A T 16: 4,311,657 L455H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Amy1 T A 3: 113,564,895 I163F probably damaging Het
Armc5 A G 7: 128,240,505 S332G probably benign Het
Brd4 T C 17: 32,198,086 probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Chrna1 A G 2: 73,568,232 S288P probably damaging Het
Cpe T A 8: 64,617,689 D174V probably benign Het
Dclre1c T C 2: 3,440,782 F235L possibly damaging Het
Ddx20 A T 3: 105,678,584 V815D probably damaging Het
Dhx9 T C 1: 153,460,274 probably null Het
Dmxl2 A C 9: 54,401,523 H1981Q probably benign Het
Doc2a A C 7: 126,851,431 D293A probably damaging Het
Eif2a C T 3: 58,548,530 R317C probably damaging Het
Fes A T 7: 80,383,986 Y172* probably null Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Glul G A 1: 153,907,324 M214I probably benign Het
Gm14496 A G 2: 182,001,004 I823V probably benign Het
Gm6665 T C 18: 31,820,265 N50S probably benign Het
Gm6729 T C 10: 86,540,918 noncoding transcript Het
Gpr21 T A 2: 37,518,338 C299S probably damaging Het
Hapln2 T A 3: 88,023,377 N196Y probably benign Het
Hsd17b12 A G 2: 94,045,392 V196A probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Kansl1 A T 11: 104,343,640 L680Q probably damaging Het
Kcna3 T C 3: 107,037,935 S505P possibly damaging Het
Klra1 A C 6: 130,372,865 N203K probably benign Het
L3mbtl2 T A 15: 81,675,621 I236N probably damaging Het
Mcm3ap C A 10: 76,507,361 P1696T probably damaging Het
Mecom T C 3: 29,957,442 D647G probably damaging Het
Mn1 A G 5: 111,418,746 D194G probably damaging Het
Muc5ac A G 7: 141,793,689 N407S probably benign Het
Mx2 C T 16: 97,560,351 R584C probably benign Het
Myo1c A G 11: 75,668,229 R597G probably benign Het
Nav3 T C 10: 109,705,606 D1932G probably benign Het
Nwd2 T A 5: 63,794,242 D205E probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Osmr T C 15: 6,844,367 E183G possibly damaging Het
Peak1 A T 9: 56,206,687 W627R probably damaging Het
Pkd1 C A 17: 24,595,157 P4167Q probably damaging Het
Plekhg4 T A 8: 105,378,385 L560Q probably damaging Het
Prg4 C T 1: 150,449,999 W1217* probably null Het
Prkdc A G 16: 15,714,266 I1465V probably benign Het
Pus1 A G 5: 110,777,639 F105S probably damaging Het
Ranbp3l T C 15: 9,057,125 S154P probably damaging Het
Rhbdl1 C T 17: 25,835,539 G211S probably damaging Het
Rnf219 T C 14: 104,479,186 K584E probably benign Het
Rrp36 C T 17: 46,672,745 R47Q possibly damaging Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Sash1 T A 10: 8,727,908 N1127Y possibly damaging Het
Setbp1 C T 18: 78,858,362 E697K possibly damaging Het
Slc27a3 A T 3: 90,386,317 V587E probably benign Het
Slc38a2 A G 15: 96,691,162 F454L possibly damaging Het
Sprn A T 7: 140,153,545 probably benign Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tbc1d1 A G 5: 64,311,221 E732G probably damaging Het
Tnfaip3 A G 10: 19,003,607 F671S possibly damaging Het
Tor1aip2 C A 1: 156,064,794 P282Q probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Ttll2 A T 17: 7,352,390 F46Y probably damaging Het
Ttn A G 2: 76,734,150 S28548P probably damaging Het
Tubb5 T C 17: 35,835,298 Y340C probably benign Het
Usp32 A T 11: 85,007,004 C1170* probably null Het
Usp54 G T 14: 20,560,904 H1281Q probably benign Het
Vgll4 C T 6: 114,921,335 G22S probably benign Het
Vmn2r120 T A 17: 57,524,839 I317F probably benign Het
Zdhhc5 A T 2: 84,693,427 F225Y probably damaging Het
Zfp652 A G 11: 95,764,025 E418G possibly damaging Het
Other mutations in Fancc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Fancc APN 13 63400245 missense probably damaging 1.00
IGL00846:Fancc APN 13 63340456 missense possibly damaging 0.89
IGL01404:Fancc APN 13 63361638 missense probably damaging 1.00
IGL02592:Fancc APN 13 63360197 missense probably damaging 1.00
IGL02625:Fancc APN 13 63398151 missense probably damaging 0.99
canneloni UTSW 13 63331823 intron probably benign
macaroni UTSW 13 63321865 critical splice donor site probably null
R0362:Fancc UTSW 13 63398156 missense possibly damaging 0.86
R0554:Fancc UTSW 13 63317469 missense probably benign 0.32
R0626:Fancc UTSW 13 63317391 missense probably damaging 0.97
R0627:Fancc UTSW 13 63317478 missense probably damaging 0.99
R0726:Fancc UTSW 13 63323411 missense probably benign 0.01
R0734:Fancc UTSW 13 63331842 missense probably damaging 1.00
R1363:Fancc UTSW 13 63361598 missense probably damaging 1.00
R1587:Fancc UTSW 13 63340432 missense probably benign 0.32
R4585:Fancc UTSW 13 63347564 missense probably benign 0.14
R4586:Fancc UTSW 13 63347564 missense probably benign 0.14
R4608:Fancc UTSW 13 63331823 intron probably benign
R5159:Fancc UTSW 13 63321865 critical splice donor site probably null
R5401:Fancc UTSW 13 63402953 missense probably damaging 1.00
R5561:Fancc UTSW 13 63317387 missense possibly damaging 0.85
R5699:Fancc UTSW 13 63330632 splice site probably null
R6200:Fancc UTSW 13 63360248 missense probably damaging 1.00
R6448:Fancc UTSW 13 63340428 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGCTTTCTTTGTGAACAAGACTCC -3'
(R):5'- CCATGGGAAGGCCATATGAG -3'

Sequencing Primer
(F):5'- TAGCCAGTGTCAGAGCATGC -3'
(R):5'- GGCCATATGAGAGAGGCTG -3'
Posted On2014-07-14