Incidental Mutation 'R1922:Vmn2r120'
ID213192
Institutional Source Beutler Lab
Gene Symbol Vmn2r120
Ensembl Gene ENSMUSG00000090655
Gene Namevomeronasal 2, receptor 120
SynonymsEG224916
MMRRC Submission 039940-MU
Accession Numbers

Genbank: NM_001104591; MGI: 3644483

Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R1922 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location57508783-57545314 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57524839 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 317 (I317F)
Ref Sequence ENSEMBL: ENSMUSP00000129296 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165781]
Predicted Effect probably benign
Transcript: ENSMUST00000165781
AA Change: I317F

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000129296
Gene: ENSMUSG00000090655
AA Change: I317F

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 80 474 5.9e-42 PFAM
Pfam:NCD3G 517 570 7.5e-22 PFAM
Pfam:7tm_3 598 836 1.3e-54 PFAM
Meta Mutation Damage Score 0.1024 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.1%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A C 6: 48,931,286 I407L probably benign Het
Abca12 G T 1: 71,319,924 N574K probably benign Het
Adcy9 A T 16: 4,311,657 L455H probably damaging Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Amy1 T A 3: 113,564,895 I163F probably damaging Het
Armc5 A G 7: 128,240,505 S332G probably benign Het
Brd4 T C 17: 32,198,086 probably benign Het
Cadps T C 14: 12,465,859 K1017R possibly damaging Het
Cfap45 A G 1: 172,545,112 E458G probably damaging Het
Chrna1 A G 2: 73,568,232 S288P probably damaging Het
Cpe T A 8: 64,617,689 D174V probably benign Het
Dclre1c T C 2: 3,440,782 F235L possibly damaging Het
Ddx20 A T 3: 105,678,584 V815D probably damaging Het
Dhx9 T C 1: 153,460,274 probably null Het
Dmxl2 A C 9: 54,401,523 H1981Q probably benign Het
Doc2a A C 7: 126,851,431 D293A probably damaging Het
Eif2a C T 3: 58,548,530 R317C probably damaging Het
Fancc A G 13: 63,330,567 V318A possibly damaging Het
Fes A T 7: 80,383,986 Y172* probably null Het
Gipc3 T A 10: 81,338,215 I242F probably damaging Het
Glul G A 1: 153,907,324 M214I probably benign Het
Gm14496 A G 2: 182,001,004 I823V probably benign Het
Gm6665 T C 18: 31,820,265 N50S probably benign Het
Gm6729 T C 10: 86,540,918 noncoding transcript Het
Gpr21 T A 2: 37,518,338 C299S probably damaging Het
Hapln2 T A 3: 88,023,377 N196Y probably benign Het
Hsd17b12 A G 2: 94,045,392 V196A probably benign Het
Kalrn A T 16: 34,392,093 D28E probably benign Het
Kansl1 A T 11: 104,343,640 L680Q probably damaging Het
Kcna3 T C 3: 107,037,935 S505P possibly damaging Het
Klra1 A C 6: 130,372,865 N203K probably benign Het
L3mbtl2 T A 15: 81,675,621 I236N probably damaging Het
Mcm3ap C A 10: 76,507,361 P1696T probably damaging Het
Mecom T C 3: 29,957,442 D647G probably damaging Het
Mn1 A G 5: 111,418,746 D194G probably damaging Het
Muc5ac A G 7: 141,793,689 N407S probably benign Het
Mx2 C T 16: 97,560,351 R584C probably benign Het
Myo1c A G 11: 75,668,229 R597G probably benign Het
Nav3 T C 10: 109,705,606 D1932G probably benign Het
Nwd2 T A 5: 63,794,242 D205E probably benign Het
Olfr1353 T A 10: 78,970,141 L164* probably null Het
Olfr885 T C 9: 38,061,685 Y122H probably damaging Het
Osmr T C 15: 6,844,367 E183G possibly damaging Het
Peak1 A T 9: 56,206,687 W627R probably damaging Het
Pkd1 C A 17: 24,595,157 P4167Q probably damaging Het
Plekhg4 T A 8: 105,378,385 L560Q probably damaging Het
Prg4 C T 1: 150,449,999 W1217* probably null Het
Prkdc A G 16: 15,714,266 I1465V probably benign Het
Pus1 A G 5: 110,777,639 F105S probably damaging Het
Ranbp3l T C 15: 9,057,125 S154P probably damaging Het
Rhbdl1 C T 17: 25,835,539 G211S probably damaging Het
Rnf219 T C 14: 104,479,186 K584E probably benign Het
Rrp36 C T 17: 46,672,745 R47Q possibly damaging Het
Rtp1 T A 16: 23,431,410 I175N probably damaging Het
Sash1 T A 10: 8,727,908 N1127Y possibly damaging Het
Setbp1 C T 18: 78,858,362 E697K possibly damaging Het
Slc27a3 A T 3: 90,386,317 V587E probably benign Het
Slc38a2 A G 15: 96,691,162 F454L possibly damaging Het
Sprn A T 7: 140,153,545 probably benign Het
St14 A G 9: 31,089,870 V855A possibly damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tbc1d1 A G 5: 64,311,221 E732G probably damaging Het
Tnfaip3 A G 10: 19,003,607 F671S possibly damaging Het
Tor1aip2 C A 1: 156,064,794 P282Q probably damaging Het
Ttc7b C T 12: 100,415,130 probably null Het
Ttll2 A T 17: 7,352,390 F46Y probably damaging Het
Ttn A G 2: 76,734,150 S28548P probably damaging Het
Tubb5 T C 17: 35,835,298 Y340C probably benign Het
Usp32 A T 11: 85,007,004 C1170* probably null Het
Usp54 G T 14: 20,560,904 H1281Q probably benign Het
Vgll4 C T 6: 114,921,335 G22S probably benign Het
Zdhhc5 A T 2: 84,693,427 F225Y probably damaging Het
Zfp652 A G 11: 95,764,025 E418G possibly damaging Het
Other mutations in Vmn2r120
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Vmn2r120 APN 17 57525732 missense possibly damaging 0.86
IGL01346:Vmn2r120 APN 17 57545232 missense probably benign 0.11
IGL01996:Vmn2r120 APN 17 57525222 missense possibly damaging 0.92
IGL02503:Vmn2r120 APN 17 57509385 missense probably benign 0.40
IGL02582:Vmn2r120 APN 17 57524724 missense probably damaging 0.99
IGL02747:Vmn2r120 APN 17 57524719 missense probably benign 0.19
IGL02896:Vmn2r120 APN 17 57509008 missense probably damaging 1.00
IGL03139:Vmn2r120 APN 17 57524742 missense probably benign 0.39
IGL03342:Vmn2r120 APN 17 57509372 missense probably benign 0.03
A4554:Vmn2r120 UTSW 17 57525715 missense probably benign 0.01
R0207:Vmn2r120 UTSW 17 57525052 missense probably benign 0.17
R0472:Vmn2r120 UTSW 17 57524518 missense probably benign 0.03
R0517:Vmn2r120 UTSW 17 57508949 missense probably damaging 1.00
R1109:Vmn2r120 UTSW 17 57525829 missense probably benign 0.09
R1316:Vmn2r120 UTSW 17 57525939 missense probably benign 0.28
R1543:Vmn2r120 UTSW 17 57522374 missense probably benign 0.09
R1795:Vmn2r120 UTSW 17 57525038 missense probably benign 0.35
R1850:Vmn2r120 UTSW 17 57525826 missense probably benign 0.19
R1920:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R1921:Vmn2r120 UTSW 17 57524839 missense probably benign 0.01
R2063:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2064:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2065:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2067:Vmn2r120 UTSW 17 57524553 missense possibly damaging 0.88
R2286:Vmn2r120 UTSW 17 57508958 missense probably damaging 1.00
R2291:Vmn2r120 UTSW 17 57509479 missense probably damaging 1.00
R3416:Vmn2r120 UTSW 17 57509241 missense possibly damaging 0.89
R3874:Vmn2r120 UTSW 17 57524954 missense probably benign 0.40
R4023:Vmn2r120 UTSW 17 57536718 missense possibly damaging 0.92
R4024:Vmn2r120 UTSW 17 57536718 missense possibly damaging 0.92
R4348:Vmn2r120 UTSW 17 57522466 missense possibly damaging 0.47
R4409:Vmn2r120 UTSW 17 57509477 missense probably damaging 1.00
R4610:Vmn2r120 UTSW 17 57509120 missense probably damaging 1.00
R4771:Vmn2r120 UTSW 17 57524887 missense probably damaging 1.00
R4786:Vmn2r120 UTSW 17 57522048 missense probably benign 0.14
R4927:Vmn2r120 UTSW 17 57509125 missense probably damaging 1.00
R5285:Vmn2r120 UTSW 17 57536703 missense probably damaging 1.00
R5566:Vmn2r120 UTSW 17 57545290 missense possibly damaging 0.95
R5578:Vmn2r120 UTSW 17 57522514 missense probably benign 0.01
R5643:Vmn2r120 UTSW 17 57524977 missense probably benign 0.01
R5644:Vmn2r120 UTSW 17 57524977 missense probably benign 0.01
R5781:Vmn2r120 UTSW 17 57524938 missense probably benign 0.00
R6084:Vmn2r120 UTSW 17 57525721 missense probably benign 0.15
R6120:Vmn2r120 UTSW 17 57525973 missense probably benign 0.02
R6160:Vmn2r120 UTSW 17 57509418 missense probably benign 0.03
R6248:Vmn2r120 UTSW 17 57545287 missense probably benign 0.03
R6256:Vmn2r120 UTSW 17 57524700 nonsense probably null
R6730:Vmn2r120 UTSW 17 57525012 missense probably benign 0.03
R6821:Vmn2r120 UTSW 17 57536659 missense probably benign 0.00
R6868:Vmn2r120 UTSW 17 57545218 missense probably benign 0.00
R6880:Vmn2r120 UTSW 17 57509187 missense probably damaging 1.00
R6986:Vmn2r120 UTSW 17 57509340 missense probably damaging 1.00
R7276:Vmn2r120 UTSW 17 57524881 missense probably benign 0.11
R7373:Vmn2r120 UTSW 17 57509406 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TCGGTGCCAAGGTAACAATGC -3'
(R):5'- TGATCTGCTCAGCACTGATCC -3'

Sequencing Primer
(F):5'- TGCCAAGGATCCATTGGATG -3'
(R):5'- ACTGATCCTGCAATCATGGG -3'
Posted On2014-07-14