Mutagenetix > Incidental Mutations

Incidental Mutation 'R1924:Pdlim2'

213306

Institutional Source

Beutler Lab

Gene Symbol

Pdlim2

Ensembl Gene

ENSMUSG00000022090

Gene Name

PDZ and LIM domain 2

Synonyms

SLIM, 4732462F18Rik, mystique

MMRRC Submission

039942-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.096) question?

Stock #

R1924 (G1)

Quality Score

168

Status

Validated

Chromosome

Chromosomal Location

70164218-70177681 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 70164779 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 296 (R296H)

Ref Sequence

ENSEMBL: ENSMUSP00000116200 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022681] [ENSMUST00000127836] [ENSMUST00000129174] [ENSMUST00000143393] [ENSMUST00000153735]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022681
AA Change: R296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022681
Gene: ENSMUSG00000022090
AA Change: R296H

Domain	Start	End	E-Value	Type
PDZ	11	84	3.41e-17	SMART
low complexity region	129	144	N/A	INTRINSIC
Pfam:DUF4749	169	256	4.4e-12	PFAM
low complexity region	259	271	N/A	INTRINSIC
LIM	282	334	1.25e-6	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000125300
AA Change: R97H

SMART Domains

Protein: ENSMUSP00000116694
Gene: ENSMUSG00000022090
AA Change: R97H

Domain	Start	End	E-Value	Type
Pfam:DUF4749	7	58	6.4e-13	PFAM
low complexity region	61	73	N/A	INTRINSIC
LIM	84	136	1.25e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000127836
AA Change: R75H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000141050
Gene: ENSMUSG00000022090
AA Change: R75H

Domain	Start	End	E-Value	Type
low complexity region	20	29	N/A	INTRINSIC
low complexity region	38	50	N/A	INTRINSIC
LIM	61	113	5.9e-9	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000129174
AA Change: R75H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000139820
Gene: ENSMUSG00000022090
AA Change: R75H

Domain	Start	End	E-Value	Type
low complexity region	20	29	N/A	INTRINSIC
low complexity region	38	50	N/A	INTRINSIC
LIM	61	113	5.9e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135944

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141363

Predicted Effect

probably benign
Transcript: ENSMUST00000143393

SMART Domains

Protein: ENSMUSP00000119222
Gene: ENSMUSG00000022090

Domain	Start	End	E-Value	Type
PDZ	11	84	3.41e-17	SMART
low complexity region	129	144	N/A	INTRINSIC
low complexity region	199	210	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000153735
AA Change: R296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116200
Gene: ENSMUSG00000022090
AA Change: R296H

Domain	Start	End	E-Value	Type
PDZ	11	84	3.41e-17	SMART
low complexity region	129	144	N/A	INTRINSIC
low complexity region	199	210	N/A	INTRINSIC
low complexity region	241	250	N/A	INTRINSIC
low complexity region	259	271	N/A	INTRINSIC
LIM	282	334	1.25e-6	SMART

Meta Mutation Damage Score

0.212

Coding Region Coverage

1x: 97.5%
3x: 96.9%
10x: 95.4%
20x: 92.9%

Validation Efficiency

94% (63/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALP subfamily of PDZ-LIM domain proteins. The encoded protein suppresses anchorage-dependent growth and promotes cell migration and adhesion through interactions with the actin cytoskeleton via the PDZ domain. The encoded protein is also a putative tumor suppressor protein, and decreased expression of this gene is associated with several malignancies including breast cancer and adult T-cell leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display increased IFN-gamma production by Th1 cells and an enhanced inflammatory response to in vivo challenge with heat-killed Listeria monocytogenes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	G	A	5: 114,230,720	M1666I	possibly damaging	Het
Adamts13	A	T	2: 26,984,141	Q434L	probably damaging	Het
Adgrg3	G	A	8: 95,035,934	R204H	probably benign	Het
Arhgef28	A	C	13: 97,936,816		probably benign	Het
AU041133	T	A	10: 82,151,267	C251*	probably null	Het
Axin2	T	A	11: 108,942,968	N580K	probably benign	Het
C4b	A	G	17: 34,729,657	C1560R	probably damaging	Het
C530008M17Rik	A	T	5: 76,858,623	T944S	unknown	Het
Cacna1g	A	G	11: 94,444,054	I809T	possibly damaging	Het
Cacna1s	C	A	1: 136,089,017		probably null	Het
Cadps2	T	C	6: 23,688,858	S151G	probably damaging	Het
Capn1	T	C	19: 5,990,056		probably null	Het
Capn9	A	G	8: 124,576,226	S28G	probably benign	Het
Ccdc73	A	G	2: 104,992,292	D862G	probably damaging	Het
Cdk17	T	C	10: 93,226,117	L237P	probably damaging	Het
Chad	A	C	11: 94,565,558	N154T	possibly damaging	Het
Cog1	C	T	11: 113,656,212	T544I	probably benign	Het
Ctnna2	T	C	6: 76,954,847	E590G	possibly damaging	Het
Dapk2	T	A	9: 66,165,360	M6K	probably benign	Het
Dchs1	T	C	7: 105,772,280	E311G	possibly damaging	Het
Ddr2	T	A	1: 169,982,072	T779S	probably benign	Het
Dhtkd1	A	G	2: 5,911,933	V644A	probably damaging	Het
Dock2	A	G	11: 34,464,934	V147A	possibly damaging	Het
Ear10	A	T	14: 43,922,900	*157K	probably null	Het
Gm10801	T	C	2: 98,663,852	I113T	probably damaging	Het
Gmps	T	G	3: 63,998,628	C449G	probably damaging	Het
Grin3a	A	G	4: 49,844,988	S32P	possibly damaging	Het
Igkv1-115	A	T	6: 68,161,608	D65V	probably damaging	Het
Klk1b4	A	G	7: 44,209,681	N41S	probably benign	Het
Krt26	CTAGTA	CTA	11: 99,333,526		probably benign	Het
Lrrc8a	T	A	2: 30,255,250	D25E	probably damaging	Het
Muc5b	A	G	7: 141,868,223	R4426G	possibly damaging	Het
Muc6	G	A	7: 141,638,400	S2120F	possibly damaging	Het
Myo5a	G	T	9: 75,116,207	D17Y	probably damaging	Het
Nat1	C	G	8: 67,491,424	L154V	probably benign	Het
Nek3	T	A	8: 22,157,031	T163S	probably damaging	Het
Olfr12	T	C	1: 92,620,803	L299P	probably damaging	Het
Olfr225	G	T	11: 59,613,123	R53L	possibly damaging	Het
Olfr508	A	G	7: 108,630,355	D121G	probably damaging	Het
Olfr773	A	G	10: 129,187,175	I82T	possibly damaging	Het
Olfr926	T	A	9: 38,877,851	I225N	probably damaging	Het
Olfr951	A	T	9: 39,393,867	E22D	possibly damaging	Het
Osr1	T	G	12: 9,579,268	L47R	probably damaging	Het
Pik3ap1	T	A	19: 41,302,614	N493I	possibly damaging	Het
Polr3e	T	A	7: 120,940,597	N522K	probably damaging	Het
Rabgap1	T	A	2: 37,495,759		probably null	Het
Rp1l1	C	A	14: 64,031,543	A1526E	probably benign	Het
Scn3a	T	A	2: 65,461,534	I1623F	probably damaging	Het
Serpinb9e	A	G	13: 33,253,445	T104A	probably benign	Het
Sh3rf3	T	C	10: 59,104,167		probably benign	Het
Slc30a3	A	G	5: 31,088,404	Y213H	probably damaging	Het
Sptbn4	C	T	7: 27,407,138	R955H	probably damaging	Het
Tfb1m	A	T	17: 3,519,671	Y307N	probably damaging	Het
Tnrc6b	G	T	15: 80,884,206		probably null	Het
Tns2	C	T	15: 102,108,934	R281C	probably damaging	Het
Ulk1	A	G	5: 110,791,070	Y501H	probably damaging	Het
Wdr66	A	G	5: 123,302,739	I1120V	possibly damaging	Het
Zbtb17	A	G	4: 141,464,603	H315R	probably damaging	Het
Zeb2	A	G	2: 45,002,612	Y142H	probably damaging	Het
Zfr	T	C	15: 12,160,629	S763P	possibly damaging	Het

Other mutations in Pdlim2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02295:Pdlim2	APN	14	70166083	splice site	probably benign
IGL02338:Pdlim2	APN	14	70174457	missense	probably damaging	1.00
IGL03286:Pdlim2	APN	14	70174476	missense	possibly damaging	0.88
R0751:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R0768:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R0832:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R1167:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R1207:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R1207:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R1343:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R1412:Pdlim2	UTSW	14	70174324	splice site	probably benign
R1595:Pdlim2	UTSW	14	70164744	missense	probably damaging	1.00
R1689:Pdlim2	UTSW	14	70171239	missense	probably damaging	0.98
R1703:Pdlim2	UTSW	14	70174335	critical splice donor site	probably null
R1843:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R1845:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R1923:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R1925:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R2004:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R2005:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R2202:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R2205:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R2237:Pdlim2	UTSW	14	70171249	missense	probably benign	0.05
R2843:Pdlim2	UTSW	14	70166100	missense	probably benign	0.02
R4042:Pdlim2	UTSW	14	70164779	missense	probably damaging	1.00
R4965:Pdlim2	UTSW	14	70168015	unclassified	probably benign
R4971:Pdlim2	UTSW	14	70167759	missense	probably damaging	1.00
R5951:Pdlim2	UTSW	14	70167780	missense	probably benign	0.06
R6252:Pdlim2	UTSW	14	70167688	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCTCTCAGTATAATCATGTCTGC -3'
(R):5'- TGGGGTTGGTAAAATGAAATTCCTG -3'

Sequencing Primer
(F):5'- AATCATGTCTGCAGAGTCTGAG -3'
(R):5'- AAATTCCTGAGAGAGAGGCTTTTG -3'

Posted On

2014-07-14