Incidental Mutation 'R1924:Pdlim2'
ID213306
Institutional Source Beutler Lab
Gene Symbol Pdlim2
Ensembl Gene ENSMUSG00000022090
Gene NamePDZ and LIM domain 2
SynonymsSLIM, 4732462F18Rik, mystique
MMRRC Submission 039942-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.096) question?
Stock #R1924 (G1)
Quality Score168
Status Validated
Chromosome14
Chromosomal Location70164218-70177681 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70164779 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 296 (R296H)
Ref Sequence ENSEMBL: ENSMUSP00000116200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022681] [ENSMUST00000127836] [ENSMUST00000129174] [ENSMUST00000143393] [ENSMUST00000153735]
Predicted Effect probably damaging
Transcript: ENSMUST00000022681
AA Change: R296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022681
Gene: ENSMUSG00000022090
AA Change: R296H

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
Pfam:DUF4749 169 256 4.4e-12 PFAM
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Predicted Effect unknown
Transcript: ENSMUST00000125300
AA Change: R97H
SMART Domains Protein: ENSMUSP00000116694
Gene: ENSMUSG00000022090
AA Change: R97H

DomainStartEndE-ValueType
Pfam:DUF4749 7 58 6.4e-13 PFAM
low complexity region 61 73 N/A INTRINSIC
LIM 84 136 1.25e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127836
AA Change: R75H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141050
Gene: ENSMUSG00000022090
AA Change: R75H

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000129174
AA Change: R75H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000139820
Gene: ENSMUSG00000022090
AA Change: R75H

DomainStartEndE-ValueType
low complexity region 20 29 N/A INTRINSIC
low complexity region 38 50 N/A INTRINSIC
LIM 61 113 5.9e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135944
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141363
Predicted Effect probably benign
Transcript: ENSMUST00000143393
SMART Domains Protein: ENSMUSP00000119222
Gene: ENSMUSG00000022090

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000153735
AA Change: R296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116200
Gene: ENSMUSG00000022090
AA Change: R296H

DomainStartEndE-ValueType
PDZ 11 84 3.41e-17 SMART
low complexity region 129 144 N/A INTRINSIC
low complexity region 199 210 N/A INTRINSIC
low complexity region 241 250 N/A INTRINSIC
low complexity region 259 271 N/A INTRINSIC
LIM 282 334 1.25e-6 SMART
Meta Mutation Damage Score 0.212 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 94% (63/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ALP subfamily of PDZ-LIM domain proteins. The encoded protein suppresses anchorage-dependent growth and promotes cell migration and adhesion through interactions with the actin cytoskeleton via the PDZ domain. The encoded protein is also a putative tumor suppressor protein, and decreased expression of this gene is associated with several malignancies including breast cancer and adult T-cell leukemia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele display increased IFN-gamma production by Th1 cells and an enhanced inflammatory response to in vivo challenge with heat-killed Listeria monocytogenes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G A 5: 114,230,720 M1666I possibly damaging Het
Adamts13 A T 2: 26,984,141 Q434L probably damaging Het
Adgrg3 G A 8: 95,035,934 R204H probably benign Het
Arhgef28 A C 13: 97,936,816 probably benign Het
AU041133 T A 10: 82,151,267 C251* probably null Het
Axin2 T A 11: 108,942,968 N580K probably benign Het
C4b A G 17: 34,729,657 C1560R probably damaging Het
C530008M17Rik A T 5: 76,858,623 T944S unknown Het
Cacna1g A G 11: 94,444,054 I809T possibly damaging Het
Cacna1s C A 1: 136,089,017 probably null Het
Cadps2 T C 6: 23,688,858 S151G probably damaging Het
Capn1 T C 19: 5,990,056 probably null Het
Capn9 A G 8: 124,576,226 S28G probably benign Het
Ccdc73 A G 2: 104,992,292 D862G probably damaging Het
Cdk17 T C 10: 93,226,117 L237P probably damaging Het
Chad A C 11: 94,565,558 N154T possibly damaging Het
Cog1 C T 11: 113,656,212 T544I probably benign Het
Ctnna2 T C 6: 76,954,847 E590G possibly damaging Het
Dapk2 T A 9: 66,165,360 M6K probably benign Het
Dchs1 T C 7: 105,772,280 E311G possibly damaging Het
Ddr2 T A 1: 169,982,072 T779S probably benign Het
Dhtkd1 A G 2: 5,911,933 V644A probably damaging Het
Dock2 A G 11: 34,464,934 V147A possibly damaging Het
Ear10 A T 14: 43,922,900 *157K probably null Het
Gm10801 T C 2: 98,663,852 I113T probably damaging Het
Gmps T G 3: 63,998,628 C449G probably damaging Het
Grin3a A G 4: 49,844,988 S32P possibly damaging Het
Igkv1-115 A T 6: 68,161,608 D65V probably damaging Het
Klk1b4 A G 7: 44,209,681 N41S probably benign Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrrc8a T A 2: 30,255,250 D25E probably damaging Het
Muc5b A G 7: 141,868,223 R4426G possibly damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myo5a G T 9: 75,116,207 D17Y probably damaging Het
Nat1 C G 8: 67,491,424 L154V probably benign Het
Nek3 T A 8: 22,157,031 T163S probably damaging Het
Olfr12 T C 1: 92,620,803 L299P probably damaging Het
Olfr225 G T 11: 59,613,123 R53L possibly damaging Het
Olfr508 A G 7: 108,630,355 D121G probably damaging Het
Olfr773 A G 10: 129,187,175 I82T possibly damaging Het
Olfr926 T A 9: 38,877,851 I225N probably damaging Het
Olfr951 A T 9: 39,393,867 E22D possibly damaging Het
Osr1 T G 12: 9,579,268 L47R probably damaging Het
Pik3ap1 T A 19: 41,302,614 N493I possibly damaging Het
Polr3e T A 7: 120,940,597 N522K probably damaging Het
Rabgap1 T A 2: 37,495,759 probably null Het
Rp1l1 C A 14: 64,031,543 A1526E probably benign Het
Scn3a T A 2: 65,461,534 I1623F probably damaging Het
Serpinb9e A G 13: 33,253,445 T104A probably benign Het
Sh3rf3 T C 10: 59,104,167 probably benign Het
Slc30a3 A G 5: 31,088,404 Y213H probably damaging Het
Sptbn4 C T 7: 27,407,138 R955H probably damaging Het
Tfb1m A T 17: 3,519,671 Y307N probably damaging Het
Tnrc6b G T 15: 80,884,206 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ulk1 A G 5: 110,791,070 Y501H probably damaging Het
Wdr66 A G 5: 123,302,739 I1120V possibly damaging Het
Zbtb17 A G 4: 141,464,603 H315R probably damaging Het
Zeb2 A G 2: 45,002,612 Y142H probably damaging Het
Zfr T C 15: 12,160,629 S763P possibly damaging Het
Other mutations in Pdlim2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02295:Pdlim2 APN 14 70166083 splice site probably benign
IGL02338:Pdlim2 APN 14 70174457 missense probably damaging 1.00
IGL03286:Pdlim2 APN 14 70174476 missense possibly damaging 0.88
R0751:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R0768:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R0832:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1167:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1207:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1343:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1412:Pdlim2 UTSW 14 70174324 splice site probably benign
R1595:Pdlim2 UTSW 14 70164744 missense probably damaging 1.00
R1689:Pdlim2 UTSW 14 70171239 missense probably damaging 0.98
R1703:Pdlim2 UTSW 14 70174335 critical splice donor site probably null
R1843:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1845:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1923:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R1925:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2004:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2005:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2202:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2205:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R2237:Pdlim2 UTSW 14 70171249 missense probably benign 0.05
R2843:Pdlim2 UTSW 14 70166100 missense probably benign 0.02
R4042:Pdlim2 UTSW 14 70164779 missense probably damaging 1.00
R4965:Pdlim2 UTSW 14 70168015 unclassified probably benign
R4971:Pdlim2 UTSW 14 70167759 missense probably damaging 1.00
R5951:Pdlim2 UTSW 14 70167780 missense probably benign 0.06
R6252:Pdlim2 UTSW 14 70167688 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTCTCAGTATAATCATGTCTGC -3'
(R):5'- TGGGGTTGGTAAAATGAAATTCCTG -3'

Sequencing Primer
(F):5'- AATCATGTCTGCAGAGTCTGAG -3'
(R):5'- AAATTCCTGAGAGAGAGGCTTTTG -3'
Posted On2014-07-14