Incidental Mutation 'R1924:Pik3ap1'
ID213314
Institutional Source Beutler Lab
Gene Symbol Pik3ap1
Ensembl Gene ENSMUSG00000025017
Gene Namephosphoinositide-3-kinase adaptor protein 1
SynonymsBCAP, 1810044J04Rik
MMRRC Submission 039942-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1924 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location41274218-41385070 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41302614 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 493 (N493I)
Ref Sequence ENSEMBL: ENSMUSP00000052777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059672]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059672
AA Change: N493I

PolyPhen 2 Score 0.785 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000052777
Gene: ENSMUSG00000025017
AA Change: N493I

DomainStartEndE-ValueType
DBB 180 319 8.55e-75 SMART
SCOP:d1bd8__ 331 396 8e-5 SMART
Blast:ANK 336 365 1e-7 BLAST
low complexity region 533 552 N/A INTRINSIC
low complexity region 716 740 N/A INTRINSIC
low complexity region 802 808 N/A INTRINSIC
Meta Mutation Damage Score 0.036 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.9%
Validation Efficiency 94% (63/67)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene have abnormalities in B cell maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb G A 5: 114,230,720 M1666I possibly damaging Het
Adamts13 A T 2: 26,984,141 Q434L probably damaging Het
Adgrg3 G A 8: 95,035,934 R204H probably benign Het
Arhgef28 A C 13: 97,936,816 probably benign Het
AU041133 T A 10: 82,151,267 C251* probably null Het
Axin2 T A 11: 108,942,968 N580K probably benign Het
C4b A G 17: 34,729,657 C1560R probably damaging Het
C530008M17Rik A T 5: 76,858,623 T944S unknown Het
Cacna1g A G 11: 94,444,054 I809T possibly damaging Het
Cacna1s C A 1: 136,089,017 probably null Het
Cadps2 T C 6: 23,688,858 S151G probably damaging Het
Capn1 T C 19: 5,990,056 probably null Het
Capn9 A G 8: 124,576,226 S28G probably benign Het
Ccdc73 A G 2: 104,992,292 D862G probably damaging Het
Cdk17 T C 10: 93,226,117 L237P probably damaging Het
Chad A C 11: 94,565,558 N154T possibly damaging Het
Cog1 C T 11: 113,656,212 T544I probably benign Het
Ctnna2 T C 6: 76,954,847 E590G possibly damaging Het
Dapk2 T A 9: 66,165,360 M6K probably benign Het
Dchs1 T C 7: 105,772,280 E311G possibly damaging Het
Ddr2 T A 1: 169,982,072 T779S probably benign Het
Dhtkd1 A G 2: 5,911,933 V644A probably damaging Het
Dock2 A G 11: 34,464,934 V147A possibly damaging Het
Ear10 A T 14: 43,922,900 *157K probably null Het
Gm10801 T C 2: 98,663,852 I113T probably damaging Het
Gmps T G 3: 63,998,628 C449G probably damaging Het
Grin3a A G 4: 49,844,988 S32P possibly damaging Het
Igkv1-115 A T 6: 68,161,608 D65V probably damaging Het
Klk1b4 A G 7: 44,209,681 N41S probably benign Het
Krt26 CTAGTA CTA 11: 99,333,526 probably benign Het
Lrrc8a T A 2: 30,255,250 D25E probably damaging Het
Muc5b A G 7: 141,868,223 R4426G possibly damaging Het
Muc6 G A 7: 141,638,400 S2120F possibly damaging Het
Myo5a G T 9: 75,116,207 D17Y probably damaging Het
Nat1 C G 8: 67,491,424 L154V probably benign Het
Nek3 T A 8: 22,157,031 T163S probably damaging Het
Olfr12 T C 1: 92,620,803 L299P probably damaging Het
Olfr225 G T 11: 59,613,123 R53L possibly damaging Het
Olfr508 A G 7: 108,630,355 D121G probably damaging Het
Olfr773 A G 10: 129,187,175 I82T possibly damaging Het
Olfr926 T A 9: 38,877,851 I225N probably damaging Het
Olfr951 A T 9: 39,393,867 E22D possibly damaging Het
Osr1 T G 12: 9,579,268 L47R probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Polr3e T A 7: 120,940,597 N522K probably damaging Het
Rabgap1 T A 2: 37,495,759 probably null Het
Rp1l1 C A 14: 64,031,543 A1526E probably benign Het
Scn3a T A 2: 65,461,534 I1623F probably damaging Het
Serpinb9e A G 13: 33,253,445 T104A probably benign Het
Sh3rf3 T C 10: 59,104,167 probably benign Het
Slc30a3 A G 5: 31,088,404 Y213H probably damaging Het
Sptbn4 C T 7: 27,407,138 R955H probably damaging Het
Tfb1m A T 17: 3,519,671 Y307N probably damaging Het
Tnrc6b G T 15: 80,884,206 probably null Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Ulk1 A G 5: 110,791,070 Y501H probably damaging Het
Wdr66 A G 5: 123,302,739 I1120V possibly damaging Het
Zbtb17 A G 4: 141,464,603 H315R probably damaging Het
Zeb2 A G 2: 45,002,612 Y142H probably damaging Het
Zfr T C 15: 12,160,629 S763P possibly damaging Het
Other mutations in Pik3ap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Pik3ap1 APN 19 41375890 missense possibly damaging 0.95
IGL01697:Pik3ap1 APN 19 41324579 missense probably damaging 1.00
IGL01743:Pik3ap1 APN 19 41292828 splice site probably benign
IGL02006:Pik3ap1 APN 19 41302593 missense probably benign
IGL02507:Pik3ap1 APN 19 41282012 splice site probably benign
IGL02601:Pik3ap1 APN 19 41302442 missense probably benign 0.08
Pintail UTSW 19 41376146 missense probably benign 0.00
sooni UTSW 19 41327909 missense probably damaging 1.00
sothe UTSW 19 41356683 intron probably benign
FR4449:Pik3ap1 UTSW 19 41281946 small insertion probably benign
FR4548:Pik3ap1 UTSW 19 41281945 small insertion probably benign
FR4976:Pik3ap1 UTSW 19 41281945 small insertion probably benign
R0504:Pik3ap1 UTSW 19 41287490 missense probably damaging 1.00
R0505:Pik3ap1 UTSW 19 41324564 missense probably damaging 1.00
R0736:Pik3ap1 UTSW 19 41332319 missense possibly damaging 0.56
R0926:Pik3ap1 UTSW 19 41302525 missense probably benign 0.00
R1521:Pik3ap1 UTSW 19 41321558 missense probably damaging 1.00
R1681:Pik3ap1 UTSW 19 41308529 missense probably damaging 1.00
R1779:Pik3ap1 UTSW 19 41332234 missense probably damaging 1.00
R1945:Pik3ap1 UTSW 19 41274337 missense probably benign
R2327:Pik3ap1 UTSW 19 41296389 missense probably damaging 0.99
R2891:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2892:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2893:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2894:Pik3ap1 UTSW 19 41376061 missense probably benign 0.00
R2918:Pik3ap1 UTSW 19 41302531 missense probably benign 0.00
R4424:Pik3ap1 UTSW 19 41375881 missense probably benign 0.00
R4654:Pik3ap1 UTSW 19 41327909 missense probably damaging 1.00
R4811:Pik3ap1 UTSW 19 41302497 missense possibly damaging 0.67
R4855:Pik3ap1 UTSW 19 41327845 missense probably benign 0.13
R4885:Pik3ap1 UTSW 19 41375926 missense probably benign 0.28
R5119:Pik3ap1 UTSW 19 41281976 missense probably benign 0.18
R5261:Pik3ap1 UTSW 19 41376106 missense probably damaging 1.00
R5274:Pik3ap1 UTSW 19 41281952 missense possibly damaging 0.67
R5655:Pik3ap1 UTSW 19 41298241 missense possibly damaging 0.65
R5862:Pik3ap1 UTSW 19 41332345 missense probably damaging 1.00
R5924:Pik3ap1 UTSW 19 41296456 missense probably damaging 1.00
R6015:Pik3ap1 UTSW 19 41328201 missense probably benign 0.22
R6018:Pik3ap1 UTSW 19 41385016 start gained probably benign
R6515:Pik3ap1 UTSW 19 41376146 missense probably benign 0.00
R6792:Pik3ap1 UTSW 19 41321626 missense probably benign 0.14
Predicted Primers PCR Primer
(F):5'- TATGGCTCATTGTCAGGCGG -3'
(R):5'- TCTAGTGGTGAGATCGAGGCAAC -3'

Sequencing Primer
(F):5'- CATTGTCAGGCGGTGGGG -3'
(R):5'- CGGTGAAGGAGACCTTGGTCTC -3'
Posted On2014-07-14