Incidental Mutation 'R1925:Otof'
ID213336
Institutional Source Beutler Lab
Gene Symbol Otof
Ensembl Gene ENSMUSG00000062372
Gene Nameotoferlin
Synonyms
MMRRC Submission 039943-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.267) question?
Stock #R1925 (G1)
Quality Score173
Status Validated
Chromosome5
Chromosomal Location30367062-30461932 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 30394188 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 340 (N340K)
Ref Sequence ENSEMBL: ENSMUSP00000110395 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]
Predicted Effect probably benign
Transcript: ENSMUST00000074171
AA Change: N325K

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372
AA Change: N325K

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114747
AA Change: N340K

PolyPhen 2 Score 0.367 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372
AA Change: N340K

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.8e-1 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
transmembrane domain 1959 1981 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144125
SMART Domains Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150734
Meta Mutation Damage Score 0.044 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.2%
Validation Efficiency 99% (79/80)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 T C 6: 142,671,607 H577R probably damaging Het
Acvr1 T C 2: 58,447,649 M474V probably damaging Het
Adam1a A T 5: 121,519,450 C593* probably null Het
Agap2 A G 10: 127,090,875 N927S probably damaging Het
Ahctf1 T C 1: 179,770,653 H958R probably damaging Het
Apaf1 A G 10: 90,999,719 V1088A probably damaging Het
Brpf1 G T 6: 113,319,930 K958N probably damaging Het
Cadps A G 14: 12,705,726 I223T probably damaging Het
Catsperg2 T C 7: 29,697,764 M1105V probably benign Het
Clasp2 T A 9: 113,906,197 F1033L possibly damaging Het
Col4a3 T A 1: 82,700,373 I1232N unknown Het
Col4a3 T G 1: 82,711,874 probably benign Het
Comtd1 T G 14: 21,847,663 E134A probably damaging Het
Cyp2c55 A T 19: 39,034,377 T320S probably benign Het
Dlx2 T C 2: 71,546,178 N72S probably benign Het
Dnhd1 T A 7: 105,652,252 V272E probably damaging Het
Dnhd1 T A 7: 105,673,854 I523N probably damaging Het
Dpysl3 T A 18: 43,332,931 I140F probably damaging Het
Elmod2 G A 8: 83,321,464 A123V probably benign Het
Etv4 T C 11: 101,771,681 probably benign Het
F3 A T 3: 121,729,383 T81S probably damaging Het
Faf2 C T 13: 54,652,052 A224V probably damaging Het
Fbn1 A T 2: 125,363,629 M1109K probably damaging Het
Fnbp4 A G 2: 90,765,843 E586G probably damaging Het
Gm10428 G T 11: 62,753,353 probably benign Het
Gm13088 T A 4: 143,654,455 T333S probably damaging Het
Gm5884 A T 6: 128,645,087 noncoding transcript Het
Gm6471 T A 7: 142,831,582 noncoding transcript Het
Gtse1 T C 15: 85,873,738 V515A probably benign Het
H2-M2 T C 17: 37,482,500 E205G probably damaging Het
Ido1 T A 8: 24,585,290 T259S possibly damaging Het
Il1r2 A G 1: 40,115,148 Y225C probably damaging Het
Kcnq3 T G 15: 66,004,809 D495A possibly damaging Het
Lrrc49 T C 9: 60,649,490 N321D probably benign Het
Lztr1 G T 16: 17,523,383 R291L probably damaging Het
Micu1 C T 10: 59,733,161 probably benign Het
Msh5 C T 17: 35,029,952 V702I probably benign Het
Myh1 T C 11: 67,211,170 I792T probably benign Het
Nav1 T A 1: 135,607,229 probably benign Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Olfr1044 T C 2: 86,171,010 D269G probably benign Het
Olfr204 A G 16: 59,314,664 S248P probably damaging Het
Olfr266 C T 3: 106,822,372 M62I probably damaging Het
Pdlim2 C T 14: 70,164,779 R296H probably damaging Het
Plek2 T A 12: 78,894,890 Y155F probably damaging Het
Ppa1 T A 10: 61,651,609 Y38* probably null Het
Prmt9 T A 8: 77,577,339 C684S possibly damaging Het
Rasl10a A G 11: 5,059,473 D87G possibly damaging Het
Rtn4rl1 C A 11: 75,266,038 P432Q probably benign Het
Scd4 T G 19: 44,341,384 Y265D probably damaging Het
Scn5a C T 9: 119,529,019 A719T probably benign Het
Sdk1 T A 5: 142,185,285 F1968I probably benign Het
Sh3bp5 T C 14: 31,435,923 E12G probably benign Het
Slc6a12 T A 6: 121,360,526 F390I probably benign Het
Snapin A T 3: 90,490,232 D77E possibly damaging Het
Sox2 G T 3: 34,650,671 E86* probably null Het
Sparcl1 A G 5: 104,093,354 L68P probably benign Het
Sptb T A 12: 76,622,253 E562V probably damaging Het
Taar3 A T 10: 23,950,585 H343L probably benign Het
Tanc1 T A 2: 59,724,751 V51E possibly damaging Het
Tbc1d22a T C 15: 86,239,149 S128P probably damaging Het
Thada A G 17: 84,444,499 S350P probably benign Het
Tmem161b T C 13: 84,260,229 V93A probably benign Het
Tnn T C 1: 160,097,229 Y1185C probably damaging Het
Trim43a T C 9: 88,582,318 V94A probably benign Het
Ttll12 C T 15: 83,581,775 E407K probably benign Het
Ttn T C 2: 76,725,512 E30383G probably damaging Het
Vmn1r29 T A 6: 58,308,102 M269K possibly damaging Het
Vmn2r117 A G 17: 23,478,389 S110P probably benign Het
Vmn2r6 C A 3: 64,556,277 V290L possibly damaging Het
Vmn2r8 A T 5: 108,802,153 L276Q probably damaging Het
Zan C A 5: 137,425,642 C2665F unknown Het
Zfp507 C T 7: 35,793,725 R631Q probably damaging Het
Zfp983 A G 17: 21,662,017 H287R probably damaging Het
Other mutations in Otof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Otof APN 5 30375904 missense probably damaging 1.00
IGL00391:Otof APN 5 30375623 missense probably damaging 1.00
IGL00579:Otof APN 5 30399322 missense possibly damaging 0.88
IGL00671:Otof APN 5 30385753 critical splice donor site probably null
IGL01019:Otof APN 5 30405216 missense probably benign 0.01
IGL01025:Otof APN 5 30384253 missense possibly damaging 0.82
IGL01086:Otof APN 5 30376273 critical splice donor site probably null
IGL01110:Otof APN 5 30461725 missense probably damaging 1.00
IGL01160:Otof APN 5 30381535 missense probably benign 0.00
IGL01285:Otof APN 5 30405183 missense probably damaging 1.00
IGL01329:Otof APN 5 30441379 missense probably benign 0.00
IGL01337:Otof APN 5 30405777 missense possibly damaging 0.93
IGL01337:Otof APN 5 30419512 missense probably benign 0.17
IGL01834:Otof APN 5 30399220 missense probably damaging 1.00
IGL01872:Otof APN 5 30379254 splice site probably benign
IGL01969:Otof APN 5 30382483 splice site probably benign
IGL02075:Otof APN 5 30370726 missense probably benign 0.23
IGL02077:Otof APN 5 30399235 missense probably damaging 1.00
IGL02136:Otof APN 5 30373992 missense possibly damaging 0.90
IGL02227:Otof APN 5 30370784 missense probably damaging 1.00
IGL02475:Otof APN 5 30376682 missense probably damaging 1.00
IGL02812:Otof APN 5 30374082 missense probably benign 0.08
IGL02864:Otof APN 5 30386341 missense probably damaging 0.99
IGL03176:Otof APN 5 30405176 splice site probably null
R0285:Otof UTSW 5 30379533 critical splice donor site probably null
R0421:Otof UTSW 5 30371568 missense possibly damaging 0.94
R0570:Otof UTSW 5 30371881 splice site probably benign
R0599:Otof UTSW 5 30370705 missense probably damaging 1.00
R0675:Otof UTSW 5 30382361 missense probably benign 0.01
R0715:Otof UTSW 5 30394697 missense probably damaging 0.99
R1019:Otof UTSW 5 30370743 missense probably damaging 0.96
R1183:Otof UTSW 5 30371912 missense probably damaging 1.00
R1435:Otof UTSW 5 30378695 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1474:Otof UTSW 5 30379532 critical splice donor site probably null
R1524:Otof UTSW 5 30379556 missense probably benign 0.03
R1563:Otof UTSW 5 30371005 missense probably benign 0.00
R1732:Otof UTSW 5 30386471 missense probably damaging 1.00
R1822:Otof UTSW 5 30378710 missense probably benign 0.00
R1845:Otof UTSW 5 30371723 nonsense probably null
R1938:Otof UTSW 5 30376369 missense probably benign 0.00
R1968:Otof UTSW 5 30388654 missense probably damaging 1.00
R1996:Otof UTSW 5 30421037 missense probably benign 0.01
R1999:Otof UTSW 5 30388772 missense probably benign 0.19
R2027:Otof UTSW 5 30421014 missense probably benign 0.08
R2138:Otof UTSW 5 30461770 missense probably benign 0.01
R2173:Otof UTSW 5 30386374 missense probably damaging 1.00
R2245:Otof UTSW 5 30370207 missense probably damaging 1.00
R3011:Otof UTSW 5 30382840 missense probably damaging 1.00
R3105:Otof UTSW 5 30381801 missense probably benign 0.03
R3442:Otof UTSW 5 30371689 missense probably damaging 1.00
R3710:Otof UTSW 5 30385266 missense probably benign
R3715:Otof UTSW 5 30376871 nonsense probably null
R3806:Otof UTSW 5 30386499 critical splice acceptor site probably null
R3975:Otof UTSW 5 30370712 missense probably damaging 1.00
R4067:Otof UTSW 5 30399291 missense probably damaging 1.00
R4077:Otof UTSW 5 30419506 missense possibly damaging 0.89
R4166:Otof UTSW 5 30382418 missense probably damaging 1.00
R4451:Otof UTSW 5 30385164 missense possibly damaging 0.77
R4485:Otof UTSW 5 30375000 missense possibly damaging 0.77
R4600:Otof UTSW 5 30371900 missense probably damaging 1.00
R4646:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4648:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4669:Otof UTSW 5 30420974 critical splice donor site probably null
R4773:Otof UTSW 5 30394682 missense probably benign 0.05
R4839:Otof UTSW 5 30419404 missense probably damaging 0.99
R4907:Otof UTSW 5 30378661 critical splice donor site probably null
R4961:Otof UTSW 5 30383493 intron probably benign
R4991:Otof UTSW 5 30394181 missense probably damaging 1.00
R5015:Otof UTSW 5 30382894 missense probably damaging 1.00
R5036:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5038:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5253:Otof UTSW 5 30370139 missense probably damaging 1.00
R5336:Otof UTSW 5 30376720 missense probably benign 0.01
R5365:Otof UTSW 5 30381800 missense probably damaging 0.99
R5901:Otof UTSW 5 30374979 missense probably damaging 1.00
R6211:Otof UTSW 5 30371900 missense probably damaging 0.99
R6318:Otof UTSW 5 30414544 missense probably damaging 1.00
R6331:Otof UTSW 5 30371935 missense possibly damaging 0.94
R6671:Otof UTSW 5 30419533 missense probably benign
R6701:Otof UTSW 5 30370797 nonsense probably null
R6792:Otof UTSW 5 30375634 missense probably damaging 1.00
R6853:Otof UTSW 5 30388239 missense probably damaging 1.00
R6940:Otof UTSW 5 30371643 missense probably damaging 0.96
R7037:Otof UTSW 5 30381538 missense probably benign 0.32
R7060:Otof UTSW 5 30388356 missense possibly damaging 0.84
R7089:Otof UTSW 5 30371568 missense possibly damaging 0.94
R7165:Otof UTSW 5 30375620 missense probably damaging 0.99
R7178:Otof UTSW 5 30383534 missense possibly damaging 0.50
R7298:Otof UTSW 5 30388270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACGGTTTCACTGCCACTC -3'
(R):5'- CTTTCAGCAAACCAGCCCTG -3'

Sequencing Primer
(F):5'- TGCCCTACTCATGGACAGTG -3'
(R):5'- AAACCAGCCCTGTTCCCTG -3'
Posted On2014-07-14