Incidental Mutation 'R1926:Lmx1b'
ID213411
Institutional Source Beutler Lab
Gene Symbol Lmx1b
Ensembl Gene ENSMUSG00000038765
Gene NameLIM homeobox transcription factor 1 beta
SynonymsIcst, LMX1.2, GENA 191
MMRRC Submission 039944-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.925) question?
Stock #R1926 (G1)
Quality Score196
Status Not validated
Chromosome2
Chromosomal Location33560965-33640511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 33564662 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 365 (M365L)
Ref Sequence ENSEMBL: ENSMUSP00000043616 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041730]
Predicted Effect probably damaging
Transcript: ENSMUST00000041730
AA Change: M365L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000043616
Gene: ENSMUSG00000038765
AA Change: M365L

DomainStartEndE-ValueType
LIM 32 83 4.48e-17 SMART
LIM 91 145 5.51e-17 SMART
low complexity region 151 172 N/A INTRINSIC
HOX 196 258 1.51e-21 SMART
low complexity region 259 272 N/A INTRINSIC
low complexity region 328 340 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137559
SMART Domains Protein: ENSMUSP00000115288
Gene: ENSMUSG00000038765

DomainStartEndE-ValueType
LIM 9 63 5.51e-17 SMART
low complexity region 69 90 N/A INTRINSIC
low complexity region 95 118 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000176067
AA Change: M361L
SMART Domains Protein: ENSMUSP00000134944
Gene: ENSMUSG00000038765
AA Change: M361L

DomainStartEndE-ValueType
LIM 1 38 2.23e-3 SMART
LIM 46 100 5.51e-17 SMART
low complexity region 106 127 N/A INTRINSIC
HOX 151 213 1.51e-21 SMART
low complexity region 214 227 N/A INTRINSIC
low complexity region 290 302 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of LIM-homeodomain family of proteins containing two N-terminal zinc-binding LIM domains, 1 homeodomain, and a C-terminal glutamine-rich domain. It functions as a transcription factor, and is essential for the normal development of dorsal limb structures, the glomerular basement membrane, the anterior segment of the eye, and dopaminergic and serotonergic neurons. Mutations in this gene are associated with nail-patella syndrome. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2010]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit various skeletal, kidney, and eye defects. Pups also fail to suckle. Heterozygous mice with a homeodomain V265D mutation exhibit a variety of eye defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,404 T1316I probably benign Het
Acsm3 C T 7: 119,777,136 T362M probably damaging Het
Ang6 A G 14: 44,002,238 V11A possibly damaging Het
Ankrd17 A G 5: 90,244,169 Y1880H probably damaging Het
BC049730 G A 7: 24,714,116 G186R probably damaging Het
Bmi1 A G 2: 18,682,273 I55V probably benign Het
Bnipl G A 3: 95,243,043 T297M probably damaging Het
Bpifa2 T C 2: 154,013,749 V198A probably benign Het
Brms1l G T 12: 55,863,161 V239F possibly damaging Het
Ccdc158 A G 5: 92,650,788 V351A probably benign Het
Ces1c A G 8: 93,127,604 F101S possibly damaging Het
Cpb2 T C 14: 75,242,397 Y15H probably benign Het
Dglucy A T 12: 100,867,155 N535I possibly damaging Het
Dopey1 C A 9: 86,523,019 H1763Q probably damaging Het
Dpy19l1 C T 9: 24,473,824 M236I probably benign Het
Efna2 T C 10: 80,186,876 Y85H probably damaging Het
Eipr1 A T 12: 28,864,837 probably null Het
Eln A T 5: 134,706,567 Y787* probably null Het
Erbb2 G C 11: 98,425,164 E364D probably benign Het
F5 A G 1: 164,179,508 T294A probably damaging Het
Fam47e A G 5: 92,585,385 T194A possibly damaging Het
Galk1 T C 11: 116,010,247 D202G probably damaging Het
Glb1l2 T C 9: 26,771,066 D163G probably damaging Het
Gmip A G 8: 69,815,520 E408G probably benign Het
Gp1ba A T 11: 70,640,889 probably benign Het
Grm3 A T 5: 9,504,881 C804S probably damaging Het
Gzmd A G 14: 56,130,280 C179R probably damaging Het
Hadhb T A 5: 30,180,937 L415Q possibly damaging Het
Ift80 T C 3: 68,916,165 Y588C probably damaging Het
Jazf1 T C 6: 53,068,531 T13A probably benign Het
Kat8 T A 7: 127,915,295 Y67* probably null Het
Kcnab1 G A 3: 65,376,512 E384K possibly damaging Het
Lhx3 A T 2: 26,202,188 Y230* probably null Het
Ly6k G T 15: 74,797,202 P76Q probably benign Het
Map1b A T 13: 99,430,692 H1840Q unknown Het
Map3k2 A G 18: 32,203,110 I117V probably damaging Het
Med13 C A 11: 86,289,073 A1350S possibly damaging Het
Midn T C 10: 80,151,661 S109P probably damaging Het
Msh6 A G 17: 87,986,225 T803A probably benign Het
Nckap1 T C 2: 80,506,838 Y1018C probably damaging Het
Ndufc1 A T 3: 51,407,395 N63K probably benign Het
Neb A T 2: 52,279,635 S1811R probably damaging Het
Notch1 T C 2: 26,481,657 D260G probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Oas1g T C 5: 120,879,142 K283R probably benign Het
Obscn T C 11: 59,063,474 T4037A possibly damaging Het
Olfr1414 A G 1: 92,511,608 L140P probably damaging Het
Olfr449 T G 6: 42,838,313 L144R probably damaging Het
Otop2 A T 11: 115,326,955 T206S probably benign Het
Pamr1 A G 2: 102,640,997 probably null Het
Pkp1 G A 1: 135,877,673 T675I probably benign Het
Plxna2 G A 1: 194,762,450 V717I probably benign Het
Ptgs2 T C 1: 150,100,228 L2P possibly damaging Het
Rarg A G 15: 102,239,545 F277S probably damaging Het
Rassf5 A T 1: 131,212,339 I161N probably damaging Het
Rxfp4 A G 3: 88,652,352 V264A probably benign Het
Secisbp2l T A 2: 125,740,677 Q953L probably damaging Het
Serpinb9c T C 13: 33,150,235 I275V probably benign Het
Slc2a12 T C 10: 22,665,242 V332A probably damaging Het
Slc7a1 T C 5: 148,348,303 S127G probably damaging Het
Slc7a4 A T 16: 17,575,704 V77E probably damaging Het
Sp8 G A 12: 118,849,229 S273N possibly damaging Het
Spag6l G T 16: 16,763,057 N475K probably benign Het
St18 A G 1: 6,802,689 H216R probably benign Het
Tcirg1 C T 19: 3,902,843 probably benign Het
Tmeff1 A G 4: 48,658,788 Y87C probably damaging Het
Tmem94 T C 11: 115,792,900 V713A possibly damaging Het
Tnrc6b G T 15: 80,881,162 R955L probably damaging Het
Trip12 A G 1: 84,749,291 V1153A probably damaging Het
Tshz3 T C 7: 36,769,375 L263S probably damaging Het
Tubb6 G A 18: 67,401,321 probably null Het
Ube3a T C 7: 59,276,379 W302R probably damaging Het
Vcpkmt A T 12: 69,582,745 V81E probably damaging Het
Vmn1r175 T A 7: 23,809,041 I54F possibly damaging Het
Vwa8 T A 14: 79,020,635 N741K probably benign Het
Yeats2 A G 16: 20,214,426 T1034A probably benign Het
Zc3h6 G A 2: 128,997,795 R176Q probably damaging Het
Zfp207 T A 11: 80,395,427 Y424* probably null Het
Zfp729a A G 13: 67,619,557 V851A probably benign Het
Zkscan1 G T 5: 138,101,363 A450S probably benign Het
Zkscan3 A G 13: 21,396,446 V24A possibly damaging Het
Other mutations in Lmx1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Lmx1b APN 2 33639498 missense possibly damaging 0.95
IGL01583:Lmx1b APN 2 33569059 missense probably benign 0.04
IGL02885:Lmx1b APN 2 33567204 missense probably benign 0.10
R3056:Lmx1b UTSW 2 33567285 nonsense probably null
R3522:Lmx1b UTSW 2 33639531 missense probably benign 0.01
R3957:Lmx1b UTSW 2 33569094 missense probably damaging 0.99
R4888:Lmx1b UTSW 2 33564790 missense probably benign 0.01
R6115:Lmx1b UTSW 2 33569106 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGACTGTCCAAGAGCTCTGG -3'
(R):5'- TTGCTGTCCAGAGCCAAGAC -3'

Sequencing Primer
(F):5'- TCACAAGGTCTCTGTGGGCAG -3'
(R):5'- TGACGGGAAGCTAGCCCTAG -3'
Posted On2014-07-14