Incidental Mutation 'R1926:Hadhb'
ID213424
Institutional Source Beutler Lab
Gene Symbol Hadhb
Ensembl Gene ENSMUSG00000059447
Gene Namehydroxyacyl-Coenzyme A dehydrogenase/3-ketoacyl-Coenzyme A thiolase/enoyl-Coenzyme A hydratase (trifunctional protein), beta subunit
Synonyms4930479F15Rik, Mtpb
MMRRC Submission 039944-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.201) question?
Stock #R1926 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location30155248-30184593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30180937 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 415 (L415Q)
Ref Sequence ENSEMBL: ENSMUSP00000110434 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026841] [ENSMUST00000114783] [ENSMUST00000114786] [ENSMUST00000197109]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026841
AA Change: L415Q

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026841
Gene: ENSMUSG00000059447
AA Change: L415Q

DomainStartEndE-ValueType
Pfam:Thiolase_N 52 325 4.6e-96 PFAM
Pfam:ketoacyl-synt 86 193 1.8e-10 PFAM
Pfam:Thiolase_C 332 472 1.5e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114783
AA Change: L415Q

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110431
Gene: ENSMUSG00000059447
AA Change: L415Q

DomainStartEndE-ValueType
Pfam:Thiolase_N 55 325 1.4e-90 PFAM
Pfam:ketoacyl-synt 90 194 1.4e-10 PFAM
Pfam:Thiolase_C 332 472 1.3e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000114786
AA Change: L415Q

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000110434
Gene: ENSMUSG00000059447
AA Change: L415Q

DomainStartEndE-ValueType
Pfam:Thiolase_N 52 325 4.6e-96 PFAM
Pfam:ketoacyl-synt 86 193 1.8e-10 PFAM
Pfam:Thiolase_C 332 472 1.5e-51 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133414
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141236
Predicted Effect probably benign
Transcript: ENSMUST00000197109
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the beta subunit of the mitochondrial trifunctional protein, which catalyzes the last three steps of mitochondrial beta-oxidation of long chain fatty acids. The mitochondrial membrane-bound heterocomplex is composed of four alpha and four beta subunits, with the beta subunit catalyzing the 3-ketoacyl-CoA thiolase activity. The encoded protein can also bind RNA and decreases the stability of some mRNAs. The genes of the alpha and beta subunits of the mitochondrial trifunctional protein are located adjacent to each other in the human genome in a head-to-head orientation. Mutations in this gene result in trifunctional protein deficiency. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for an ENU-induced mutation display reduced postnatal weight gain, multifocal cardiac fibrosis and hepatic steatosis, and develop cardiac arrhythmias that range from a prolonged PR interval to complete atrioventricular dissociation and lead to sudden between 9 and 16 months of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,404 T1316I probably benign Het
Acsm3 C T 7: 119,777,136 T362M probably damaging Het
Ang6 A G 14: 44,002,238 V11A possibly damaging Het
Ankrd17 A G 5: 90,244,169 Y1880H probably damaging Het
BC049730 G A 7: 24,714,116 G186R probably damaging Het
Bmi1 A G 2: 18,682,273 I55V probably benign Het
Bnipl G A 3: 95,243,043 T297M probably damaging Het
Bpifa2 T C 2: 154,013,749 V198A probably benign Het
Brms1l G T 12: 55,863,161 V239F possibly damaging Het
Ccdc158 A G 5: 92,650,788 V351A probably benign Het
Ces1c A G 8: 93,127,604 F101S possibly damaging Het
Cpb2 T C 14: 75,242,397 Y15H probably benign Het
Dglucy A T 12: 100,867,155 N535I possibly damaging Het
Dopey1 C A 9: 86,523,019 H1763Q probably damaging Het
Dpy19l1 C T 9: 24,473,824 M236I probably benign Het
Efna2 T C 10: 80,186,876 Y85H probably damaging Het
Eipr1 A T 12: 28,864,837 probably null Het
Eln A T 5: 134,706,567 Y787* probably null Het
Erbb2 G C 11: 98,425,164 E364D probably benign Het
F5 A G 1: 164,179,508 T294A probably damaging Het
Fam47e A G 5: 92,585,385 T194A possibly damaging Het
Galk1 T C 11: 116,010,247 D202G probably damaging Het
Glb1l2 T C 9: 26,771,066 D163G probably damaging Het
Gmip A G 8: 69,815,520 E408G probably benign Het
Gp1ba A T 11: 70,640,889 probably benign Het
Grm3 A T 5: 9,504,881 C804S probably damaging Het
Gzmd A G 14: 56,130,280 C179R probably damaging Het
Ift80 T C 3: 68,916,165 Y588C probably damaging Het
Jazf1 T C 6: 53,068,531 T13A probably benign Het
Kat8 T A 7: 127,915,295 Y67* probably null Het
Kcnab1 G A 3: 65,376,512 E384K possibly damaging Het
Lhx3 A T 2: 26,202,188 Y230* probably null Het
Lmx1b T A 2: 33,564,662 M365L probably damaging Het
Ly6k G T 15: 74,797,202 P76Q probably benign Het
Map1b A T 13: 99,430,692 H1840Q unknown Het
Map3k2 A G 18: 32,203,110 I117V probably damaging Het
Med13 C A 11: 86,289,073 A1350S possibly damaging Het
Midn T C 10: 80,151,661 S109P probably damaging Het
Msh6 A G 17: 87,986,225 T803A probably benign Het
Nckap1 T C 2: 80,506,838 Y1018C probably damaging Het
Ndufc1 A T 3: 51,407,395 N63K probably benign Het
Neb A T 2: 52,279,635 S1811R probably damaging Het
Notch1 T C 2: 26,481,657 D260G probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Oas1g T C 5: 120,879,142 K283R probably benign Het
Obscn T C 11: 59,063,474 T4037A possibly damaging Het
Olfr1414 A G 1: 92,511,608 L140P probably damaging Het
Olfr449 T G 6: 42,838,313 L144R probably damaging Het
Otop2 A T 11: 115,326,955 T206S probably benign Het
Pamr1 A G 2: 102,640,997 probably null Het
Pkp1 G A 1: 135,877,673 T675I probably benign Het
Plxna2 G A 1: 194,762,450 V717I probably benign Het
Ptgs2 T C 1: 150,100,228 L2P possibly damaging Het
Rarg A G 15: 102,239,545 F277S probably damaging Het
Rassf5 A T 1: 131,212,339 I161N probably damaging Het
Rxfp4 A G 3: 88,652,352 V264A probably benign Het
Secisbp2l T A 2: 125,740,677 Q953L probably damaging Het
Serpinb9c T C 13: 33,150,235 I275V probably benign Het
Slc2a12 T C 10: 22,665,242 V332A probably damaging Het
Slc7a1 T C 5: 148,348,303 S127G probably damaging Het
Slc7a4 A T 16: 17,575,704 V77E probably damaging Het
Sp8 G A 12: 118,849,229 S273N possibly damaging Het
Spag6l G T 16: 16,763,057 N475K probably benign Het
St18 A G 1: 6,802,689 H216R probably benign Het
Tcirg1 C T 19: 3,902,843 probably benign Het
Tmeff1 A G 4: 48,658,788 Y87C probably damaging Het
Tmem94 T C 11: 115,792,900 V713A possibly damaging Het
Tnrc6b G T 15: 80,881,162 R955L probably damaging Het
Trip12 A G 1: 84,749,291 V1153A probably damaging Het
Tshz3 T C 7: 36,769,375 L263S probably damaging Het
Tubb6 G A 18: 67,401,321 probably null Het
Ube3a T C 7: 59,276,379 W302R probably damaging Het
Vcpkmt A T 12: 69,582,745 V81E probably damaging Het
Vmn1r175 T A 7: 23,809,041 I54F possibly damaging Het
Vwa8 T A 14: 79,020,635 N741K probably benign Het
Yeats2 A G 16: 20,214,426 T1034A probably benign Het
Zc3h6 G A 2: 128,997,795 R176Q probably damaging Het
Zfp207 T A 11: 80,395,427 Y424* probably null Het
Zfp729a A G 13: 67,619,557 V851A probably benign Het
Zkscan1 G T 5: 138,101,363 A450S probably benign Het
Zkscan3 A G 13: 21,396,446 V24A possibly damaging Het
Other mutations in Hadhb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02306:Hadhb APN 5 30166749 missense probably null 0.99
IGL02472:Hadhb APN 5 30184063 missense possibly damaging 0.68
R0110:Hadhb UTSW 5 30169485 splice site probably benign
R0481:Hadhb UTSW 5 30168545 missense probably damaging 1.00
R0578:Hadhb UTSW 5 30178806 missense probably benign
R1483:Hadhb UTSW 5 30169494 critical splice acceptor site probably null
R1552:Hadhb UTSW 5 30176933 missense probably null 0.66
R1616:Hadhb UTSW 5 30166715 missense probably damaging 1.00
R2064:Hadhb UTSW 5 30173798 splice site probably null
R5066:Hadhb UTSW 5 30164096 intron probably benign
R5298:Hadhb UTSW 5 30177011 critical splice donor site probably null
R6216:Hadhb UTSW 5 30174931 missense probably benign 0.00
R6787:Hadhb UTSW 5 30155249 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GGCTTCTCTCCTAACTTAAAACCG -3'
(R):5'- GATGACACTGCTGTGACGTAC -3'

Sequencing Primer
(F):5'- AAGACAGTAAGCCTGGTGTTGGTC -3'
(R):5'- ACACTGCTGTGACGTACCTGTC -3'
Posted On2014-07-14