Incidental Mutation 'R0126:Olfr1090'
ID21344
Institutional Source Beutler Lab
Gene Symbol Olfr1090
Ensembl Gene ENSMUSG00000075172
Gene Nameolfactory receptor 1090
SynonymsGA_x6K02T2Q125-48247345-48246404, MOR188-4
MMRRC Submission 038411-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.121) question?
Stock #R0126 (G1)
Quality Score225
Status Validated (trace)
Chromosome2
Chromosomal Location86752724-86758993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86754637 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 34 (I34L)
Ref Sequence ENSEMBL: ENSMUSP00000149968 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099875] [ENSMUST00000215991] [ENSMUST00000217043]
Predicted Effect probably damaging
Transcript: ENSMUST00000099875
AA Change: I34L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097460
Gene: ENSMUSG00000075172
AA Change: I34L

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 1.4e-47 PFAM
Pfam:7tm_1 41 290 7.1e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215991
AA Change: I34L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000217043
AA Change: I34L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.026 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.2%
  • 20x: 81.8%
Validation Efficiency 98% (102/104)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,443,730 L1730P possibly damaging Het
Adam9 T C 8: 24,970,737 N577S probably damaging Het
Add1 T C 5: 34,613,579 Y316H probably benign Het
Agpat3 T C 10: 78,278,056 D266G probably null Het
Aldh3a2 C A 11: 61,224,558 Q524H probably benign Het
Alox12b A C 11: 69,167,471 S550R probably benign Het
Ano4 T A 10: 88,952,292 I753F possibly damaging Het
AW011738 T A 4: 156,203,647 probably benign Het
B4galt3 C T 1: 171,276,165 T103M probably damaging Het
Cabs1 C T 5: 87,980,195 T235I probably damaging Het
Casc4 T C 2: 121,906,084 probably benign Het
Casq2 A G 3: 102,133,399 H272R probably damaging Het
Ccdc180 T C 4: 45,912,866 probably null Het
Cdh12 A T 15: 21,583,945 M624L probably benign Het
Cdh5 A C 8: 104,140,682 probably null Het
Col7a1 A G 9: 108,969,583 probably benign Het
Cpne2 A T 8: 94,554,933 I199F probably damaging Het
Crebbp A T 16: 4,084,063 F2399L possibly damaging Het
Defb36 T C 2: 152,612,579 C53R probably damaging Het
Degs1 T C 1: 182,279,692 M1V probably null Het
Disp2 T A 2: 118,790,338 F517Y probably damaging Het
Dnah5 A G 15: 28,246,319 D601G probably benign Het
Dnpep G A 1: 75,312,538 Q310* probably null Het
Dsg1a A G 18: 20,340,878 T1003A probably benign Het
Fbrsl1 C G 5: 110,396,040 probably benign Het
Foxh1 A T 15: 76,669,254 L116H probably damaging Het
Gigyf2 G A 1: 87,411,875 probably benign Het
Gp1ba A T 11: 70,641,033 probably benign Het
Gucy1b1 A G 3: 82,037,911 probably benign Het
Gucy2g T G 19: 55,241,166 D24A probably benign Het
Hirip3 A G 7: 126,863,442 K190R probably damaging Het
Hmmr T C 11: 40,705,954 N717D probably damaging Het
Il12b A T 11: 44,410,218 Y187F probably damaging Het
Iqgap1 A G 7: 80,738,322 I859T probably benign Het
Jmjd1c T C 10: 67,219,326 L175P probably damaging Het
Klc2 T C 19: 5,112,746 M242V possibly damaging Het
Klf3 T C 5: 64,822,103 M96T probably benign Het
Lrrc66 G T 5: 73,607,088 H871N probably benign Het
Ltn1 A T 16: 87,425,640 D168E probably benign Het
Mak T C 13: 41,032,596 D532G probably damaging Het
March6 A G 15: 31,462,005 M859T probably benign Het
Mlxipl C A 5: 135,132,323 N365K probably damaging Het
Mplkip T C 13: 17,695,752 S90P possibly damaging Het
Myo5c A T 9: 75,269,525 H584L probably benign Het
Myt1l A G 12: 29,851,720 T228A possibly damaging Het
Nxpe3 A T 16: 55,866,229 Y139N possibly damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr568 A G 7: 102,877,140 T7A probably benign Het
Pak6 C T 2: 118,690,332 S268F possibly damaging Het
Parp10 G A 15: 76,243,066 A57V probably damaging Het
Pik3r3 T A 4: 116,256,268 D69E probably damaging Het
Polr2a T G 11: 69,747,425 K105T probably damaging Het
Prdm16 A T 4: 154,328,838 probably benign Het
Prepl G A 17: 85,083,242 T96I probably benign Het
Ret C T 6: 118,165,995 probably benign Het
Rgl3 A T 9: 21,975,812 D541E probably benign Het
Rpa1 A C 11: 75,318,529 Y143D probably benign Het
Rps16 T A 7: 28,351,083 L47Q probably damaging Het
Sbno2 A T 10: 80,068,853 probably null Het
Scube1 A T 15: 83,621,063 N385K probably damaging Het
Shank2 A G 7: 144,031,355 E31G probably damaging Het
Slc38a9 G T 13: 112,729,257 C496F possibly damaging Het
Snap47 A G 11: 59,437,987 V163A probably damaging Het
Sntg2 T C 12: 30,201,261 probably benign Het
Sp7 C A 15: 102,358,460 V322F probably damaging Het
Spic T C 10: 88,676,062 K111E probably damaging Het
Sqor T C 2: 122,798,027 probably benign Het
St6galnac1 T A 11: 116,766,584 M385L probably benign Het
Synpo2 A T 3: 123,079,862 S1211T possibly damaging Het
Sytl2 T A 7: 90,396,589 V638E probably damaging Het
Taar1 T A 10: 23,920,547 S48T probably benign Het
Tbx18 T A 9: 87,729,653 D108V possibly damaging Het
Tdh C T 14: 63,497,593 probably benign Het
Tldc1 T C 8: 119,762,350 D398G possibly damaging Het
Tlr9 T A 9: 106,225,682 L724Q probably benign Het
Tmem270 T A 5: 134,902,788 Y100F probably benign Het
Trim65 G C 11: 116,124,604 probably benign Het
Trrap A T 5: 144,805,750 K1393* probably null Het
Ttc13 A G 8: 124,683,291 V523A probably damaging Het
Utrn T A 10: 12,711,475 D939V probably benign Het
Vmn1r46 G T 6: 89,976,953 M261I probably benign Het
Vwa5a A G 9: 38,737,807 probably null Het
Zfp108 A T 7: 24,260,724 T247S probably benign Het
Zfp366 A T 13: 99,228,621 I97F probably benign Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Olfr1090
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01118:Olfr1090 APN 2 86753970 missense probably benign 0.42
IGL01343:Olfr1090 APN 2 86754499 nonsense probably null
IGL01431:Olfr1090 APN 2 86754164 missense probably benign 0.12
IGL01771:Olfr1090 APN 2 86754282 missense probably benign 0.15
IGL03182:Olfr1090 APN 2 86754022 missense probably damaging 1.00
IGL03229:Olfr1090 APN 2 86754016 missense probably damaging 1.00
R0128:Olfr1090 UTSW 2 86753887 missense probably benign 0.39
R0130:Olfr1090 UTSW 2 86753887 missense probably benign 0.39
R1383:Olfr1090 UTSW 2 86754494 missense possibly damaging 0.80
R2100:Olfr1090 UTSW 2 86754561 missense possibly damaging 0.80
R2125:Olfr1090 UTSW 2 86754452 missense probably benign 0.00
R2126:Olfr1090 UTSW 2 86754452 missense probably benign 0.00
R2249:Olfr1090 UTSW 2 86754054 missense probably damaging 0.98
R3695:Olfr1090 UTSW 2 86753871 missense probably damaging 1.00
R3878:Olfr1090 UTSW 2 86754628 missense probably benign 0.02
R3940:Olfr1090 UTSW 2 86753931 missense possibly damaging 0.52
R3944:Olfr1090 UTSW 2 86754181 missense probably benign 0.17
R3975:Olfr1090 UTSW 2 86754543 missense probably damaging 0.99
R4387:Olfr1090 UTSW 2 86754120 missense probably benign 0.42
R4623:Olfr1090 UTSW 2 86754562 missense possibly damaging 0.80
R4740:Olfr1090 UTSW 2 86753811 missense probably benign 0.00
R6775:Olfr1090 UTSW 2 86754577 missense probably damaging 1.00
R7002:Olfr1090 UTSW 2 86754681 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CGCAGAGAGAATGAATAGCTCACTACC -3'
(R):5'- TATTTTCAAGCACATTCACACAAGCACG -3'

Sequencing Primer
(F):5'- GCTAGTTGTGTGGCACAAAG -3'
(R):5'- AGCTATTCACTGttttttcttctttg -3'
Posted On2013-04-11