Incidental Mutation 'R1926:Sp8'
ID213468
Institutional Source Beutler Lab
Gene Symbol Sp8
Ensembl Gene ENSMUSG00000048562
Gene Nametrans-acting transcription factor 8
SynonymsmBtd, D930049B17Rik
MMRRC Submission 039944-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.852) question?
Stock #R1926 (G1)
Quality Score142
Status Not validated
Chromosome12
Chromosomal Location118846329-118852576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118849229 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 273 (S273N)
Ref Sequence ENSEMBL: ENSMUSP00000065746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063918] [ENSMUST00000223305]
Predicted Effect possibly damaging
Transcript: ENSMUST00000063918
AA Change: S273N

PolyPhen 2 Score 0.548 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000065746
Gene: ENSMUSG00000048562
AA Change: S273N

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
low complexity region 36 60 N/A INTRINSIC
low complexity region 95 119 N/A INTRINSIC
low complexity region 132 149 N/A INTRINSIC
low complexity region 197 209 N/A INTRINSIC
low complexity region 256 276 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
ZnF_C2H2 356 380 2.63e0 SMART
ZnF_C2H2 386 410 1.84e-4 SMART
ZnF_C2H2 416 438 7.9e-4 SMART
low complexity region 439 454 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223305
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an SP family transcription factor that in mouse has been shown to be essential for proper limb development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous mutant fetuses are characterized by truncated limbs, the lack of a tail, and neural tube defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,404 T1316I probably benign Het
Acsm3 C T 7: 119,777,136 T362M probably damaging Het
Ang6 A G 14: 44,002,238 V11A possibly damaging Het
Ankrd17 A G 5: 90,244,169 Y1880H probably damaging Het
BC049730 G A 7: 24,714,116 G186R probably damaging Het
Bmi1 A G 2: 18,682,273 I55V probably benign Het
Bnipl G A 3: 95,243,043 T297M probably damaging Het
Bpifa2 T C 2: 154,013,749 V198A probably benign Het
Brms1l G T 12: 55,863,161 V239F possibly damaging Het
Ccdc158 A G 5: 92,650,788 V351A probably benign Het
Ces1c A G 8: 93,127,604 F101S possibly damaging Het
Cpb2 T C 14: 75,242,397 Y15H probably benign Het
Dglucy A T 12: 100,867,155 N535I possibly damaging Het
Dopey1 C A 9: 86,523,019 H1763Q probably damaging Het
Dpy19l1 C T 9: 24,473,824 M236I probably benign Het
Efna2 T C 10: 80,186,876 Y85H probably damaging Het
Eipr1 A T 12: 28,864,837 probably null Het
Eln A T 5: 134,706,567 Y787* probably null Het
Erbb2 G C 11: 98,425,164 E364D probably benign Het
F5 A G 1: 164,179,508 T294A probably damaging Het
Fam47e A G 5: 92,585,385 T194A possibly damaging Het
Galk1 T C 11: 116,010,247 D202G probably damaging Het
Glb1l2 T C 9: 26,771,066 D163G probably damaging Het
Gmip A G 8: 69,815,520 E408G probably benign Het
Gp1ba A T 11: 70,640,889 probably benign Het
Grm3 A T 5: 9,504,881 C804S probably damaging Het
Gzmd A G 14: 56,130,280 C179R probably damaging Het
Hadhb T A 5: 30,180,937 L415Q possibly damaging Het
Ift80 T C 3: 68,916,165 Y588C probably damaging Het
Jazf1 T C 6: 53,068,531 T13A probably benign Het
Kat8 T A 7: 127,915,295 Y67* probably null Het
Kcnab1 G A 3: 65,376,512 E384K possibly damaging Het
Lhx3 A T 2: 26,202,188 Y230* probably null Het
Lmx1b T A 2: 33,564,662 M365L probably damaging Het
Ly6k G T 15: 74,797,202 P76Q probably benign Het
Map1b A T 13: 99,430,692 H1840Q unknown Het
Map3k2 A G 18: 32,203,110 I117V probably damaging Het
Med13 C A 11: 86,289,073 A1350S possibly damaging Het
Midn T C 10: 80,151,661 S109P probably damaging Het
Msh6 A G 17: 87,986,225 T803A probably benign Het
Nckap1 T C 2: 80,506,838 Y1018C probably damaging Het
Ndufc1 A T 3: 51,407,395 N63K probably benign Het
Neb A T 2: 52,279,635 S1811R probably damaging Het
Notch1 T C 2: 26,481,657 D260G probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Oas1g T C 5: 120,879,142 K283R probably benign Het
Obscn T C 11: 59,063,474 T4037A possibly damaging Het
Olfr1414 A G 1: 92,511,608 L140P probably damaging Het
Olfr449 T G 6: 42,838,313 L144R probably damaging Het
Otop2 A T 11: 115,326,955 T206S probably benign Het
Pamr1 A G 2: 102,640,997 probably null Het
Pkp1 G A 1: 135,877,673 T675I probably benign Het
Plxna2 G A 1: 194,762,450 V717I probably benign Het
Ptgs2 T C 1: 150,100,228 L2P possibly damaging Het
Rarg A G 15: 102,239,545 F277S probably damaging Het
Rassf5 A T 1: 131,212,339 I161N probably damaging Het
Rxfp4 A G 3: 88,652,352 V264A probably benign Het
Secisbp2l T A 2: 125,740,677 Q953L probably damaging Het
Serpinb9c T C 13: 33,150,235 I275V probably benign Het
Slc2a12 T C 10: 22,665,242 V332A probably damaging Het
Slc7a1 T C 5: 148,348,303 S127G probably damaging Het
Slc7a4 A T 16: 17,575,704 V77E probably damaging Het
Spag6l G T 16: 16,763,057 N475K probably benign Het
St18 A G 1: 6,802,689 H216R probably benign Het
Tcirg1 C T 19: 3,902,843 probably benign Het
Tmeff1 A G 4: 48,658,788 Y87C probably damaging Het
Tmem94 T C 11: 115,792,900 V713A possibly damaging Het
Tnrc6b G T 15: 80,881,162 R955L probably damaging Het
Trip12 A G 1: 84,749,291 V1153A probably damaging Het
Tshz3 T C 7: 36,769,375 L263S probably damaging Het
Tubb6 G A 18: 67,401,321 probably null Het
Ube3a T C 7: 59,276,379 W302R probably damaging Het
Vcpkmt A T 12: 69,582,745 V81E probably damaging Het
Vmn1r175 T A 7: 23,809,041 I54F possibly damaging Het
Vwa8 T A 14: 79,020,635 N741K probably benign Het
Yeats2 A G 16: 20,214,426 T1034A probably benign Het
Zc3h6 G A 2: 128,997,795 R176Q probably damaging Het
Zfp207 T A 11: 80,395,427 Y424* probably null Het
Zfp729a A G 13: 67,619,557 V851A probably benign Het
Zkscan1 G T 5: 138,101,363 A450S probably benign Het
Zkscan3 A G 13: 21,396,446 V24A possibly damaging Het
Other mutations in Sp8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01358:Sp8 APN 12 118848970 missense probably damaging 1.00
IGL01783:Sp8 APN 12 118849024 missense probably benign 0.01
IGL02745:Sp8 APN 12 118849591 missense probably damaging 0.97
R0506:Sp8 UTSW 12 118848565 missense possibly damaging 0.73
R0699:Sp8 UTSW 12 118848820 small deletion probably benign
R1742:Sp8 UTSW 12 118849817 missense probably benign 0.04
R1771:Sp8 UTSW 12 118849567 missense probably damaging 1.00
R1776:Sp8 UTSW 12 118849567 missense probably damaging 1.00
R1791:Sp8 UTSW 12 118849016 missense possibly damaging 0.84
R2159:Sp8 UTSW 12 118848706 missense possibly damaging 0.83
R2223:Sp8 UTSW 12 118849738 missense probably damaging 0.99
R2304:Sp8 UTSW 12 118848569 missense possibly damaging 0.92
R3777:Sp8 UTSW 12 118849015 missense possibly damaging 0.84
R3778:Sp8 UTSW 12 118849015 missense possibly damaging 0.84
R3779:Sp8 UTSW 12 118849015 missense possibly damaging 0.84
R4323:Sp8 UTSW 12 118848436 missense probably benign 0.33
R4360:Sp8 UTSW 12 118848665 missense possibly damaging 0.90
R4428:Sp8 UTSW 12 118849203 missense possibly damaging 0.87
R4883:Sp8 UTSW 12 118849070 missense probably damaging 0.98
R4982:Sp8 UTSW 12 118848425 missense probably damaging 0.99
R5053:Sp8 UTSW 12 118849604 missense probably damaging 1.00
R5347:Sp8 UTSW 12 118848511 missense possibly damaging 0.91
R5755:Sp8 UTSW 12 118849087 missense probably damaging 0.96
R6219:Sp8 UTSW 12 118848667 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- CCCGTATGAGTCCTGGTTCAAG -3'
(R):5'- ACGTCTTGCCGTACACCTTG -3'

Sequencing Primer
(F):5'- ATGAGTCCTGGTTCAAGCCTTCG -3'
(R):5'- CCGGGATGTGGCAGCTATG -3'
Posted On2014-07-14