Incidental Mutation 'R1926:Spag6l'
ID213480
Institutional Source Beutler Lab
Gene Symbol Spag6l
Ensembl Gene ENSMUSG00000022783
Gene Namesperm associated antigen 6-like
SynonymsPF16, Spag6
MMRRC Submission 039944-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R1926 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location16753016-16829456 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 16763057 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 475 (N475K)
Ref Sequence ENSEMBL: ENSMUSP00000023468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023468]
Predicted Effect probably benign
Transcript: ENSMUST00000023468
AA Change: N475K

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000023468
Gene: ENSMUSG00000022783
AA Change: N475K

DomainStartEndE-ValueType
ARM 30 70 2.26e-3 SMART
Blast:ARM 72 112 3e-15 BLAST
ARM 114 154 3e-8 SMART
ARM 156 196 4.91e-4 SMART
ARM 198 238 1.03e-6 SMART
ARM 240 280 3.13e0 SMART
ARM 282 322 4.82e1 SMART
ARM 323 365 7.34e-3 SMART
Blast:ARM 367 409 7e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154624
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from an infertile man. This protein localizes to the tail of permeabilized human sperm and contains eight contiguous armadillo repeats, a motif known to mediate protein-protein interactions. Studies in mice suggest that this protein is involved in sperm flagellar motility and maintenance of the structural integrity of mature sperm. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Many homozygotes for a targeted null mutation exhibit reduced growth, hydrocephaly, and lethality by 8 weeks of age. Surviving males have sperm defects and are infertile, while females show reduced fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,404 T1316I probably benign Het
Acsm3 C T 7: 119,777,136 T362M probably damaging Het
Ang6 A G 14: 44,002,238 V11A possibly damaging Het
Ankrd17 A G 5: 90,244,169 Y1880H probably damaging Het
BC049730 G A 7: 24,714,116 G186R probably damaging Het
Bmi1 A G 2: 18,682,273 I55V probably benign Het
Bnipl G A 3: 95,243,043 T297M probably damaging Het
Bpifa2 T C 2: 154,013,749 V198A probably benign Het
Brms1l G T 12: 55,863,161 V239F possibly damaging Het
Ccdc158 A G 5: 92,650,788 V351A probably benign Het
Ces1c A G 8: 93,127,604 F101S possibly damaging Het
Cpb2 T C 14: 75,242,397 Y15H probably benign Het
Dglucy A T 12: 100,867,155 N535I possibly damaging Het
Dopey1 C A 9: 86,523,019 H1763Q probably damaging Het
Dpy19l1 C T 9: 24,473,824 M236I probably benign Het
Efna2 T C 10: 80,186,876 Y85H probably damaging Het
Eipr1 A T 12: 28,864,837 probably null Het
Eln A T 5: 134,706,567 Y787* probably null Het
Erbb2 G C 11: 98,425,164 E364D probably benign Het
F5 A G 1: 164,179,508 T294A probably damaging Het
Fam47e A G 5: 92,585,385 T194A possibly damaging Het
Galk1 T C 11: 116,010,247 D202G probably damaging Het
Glb1l2 T C 9: 26,771,066 D163G probably damaging Het
Gmip A G 8: 69,815,520 E408G probably benign Het
Gp1ba A T 11: 70,640,889 probably benign Het
Grm3 A T 5: 9,504,881 C804S probably damaging Het
Gzmd A G 14: 56,130,280 C179R probably damaging Het
Hadhb T A 5: 30,180,937 L415Q possibly damaging Het
Ift80 T C 3: 68,916,165 Y588C probably damaging Het
Jazf1 T C 6: 53,068,531 T13A probably benign Het
Kat8 T A 7: 127,915,295 Y67* probably null Het
Kcnab1 G A 3: 65,376,512 E384K possibly damaging Het
Lhx3 A T 2: 26,202,188 Y230* probably null Het
Lmx1b T A 2: 33,564,662 M365L probably damaging Het
Ly6k G T 15: 74,797,202 P76Q probably benign Het
Map1b A T 13: 99,430,692 H1840Q unknown Het
Map3k2 A G 18: 32,203,110 I117V probably damaging Het
Med13 C A 11: 86,289,073 A1350S possibly damaging Het
Midn T C 10: 80,151,661 S109P probably damaging Het
Msh6 A G 17: 87,986,225 T803A probably benign Het
Nckap1 T C 2: 80,506,838 Y1018C probably damaging Het
Ndufc1 A T 3: 51,407,395 N63K probably benign Het
Neb A T 2: 52,279,635 S1811R probably damaging Het
Notch1 T C 2: 26,481,657 D260G probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Oas1g T C 5: 120,879,142 K283R probably benign Het
Obscn T C 11: 59,063,474 T4037A possibly damaging Het
Olfr1414 A G 1: 92,511,608 L140P probably damaging Het
Olfr449 T G 6: 42,838,313 L144R probably damaging Het
Otop2 A T 11: 115,326,955 T206S probably benign Het
Pamr1 A G 2: 102,640,997 probably null Het
Pkp1 G A 1: 135,877,673 T675I probably benign Het
Plxna2 G A 1: 194,762,450 V717I probably benign Het
Ptgs2 T C 1: 150,100,228 L2P possibly damaging Het
Rarg A G 15: 102,239,545 F277S probably damaging Het
Rassf5 A T 1: 131,212,339 I161N probably damaging Het
Rxfp4 A G 3: 88,652,352 V264A probably benign Het
Secisbp2l T A 2: 125,740,677 Q953L probably damaging Het
Serpinb9c T C 13: 33,150,235 I275V probably benign Het
Slc2a12 T C 10: 22,665,242 V332A probably damaging Het
Slc7a1 T C 5: 148,348,303 S127G probably damaging Het
Slc7a4 A T 16: 17,575,704 V77E probably damaging Het
Sp8 G A 12: 118,849,229 S273N possibly damaging Het
St18 A G 1: 6,802,689 H216R probably benign Het
Tcirg1 C T 19: 3,902,843 probably benign Het
Tmeff1 A G 4: 48,658,788 Y87C probably damaging Het
Tmem94 T C 11: 115,792,900 V713A possibly damaging Het
Tnrc6b G T 15: 80,881,162 R955L probably damaging Het
Trip12 A G 1: 84,749,291 V1153A probably damaging Het
Tshz3 T C 7: 36,769,375 L263S probably damaging Het
Tubb6 G A 18: 67,401,321 probably null Het
Ube3a T C 7: 59,276,379 W302R probably damaging Het
Vcpkmt A T 12: 69,582,745 V81E probably damaging Het
Vmn1r175 T A 7: 23,809,041 I54F possibly damaging Het
Vwa8 T A 14: 79,020,635 N741K probably benign Het
Yeats2 A G 16: 20,214,426 T1034A probably benign Het
Zc3h6 G A 2: 128,997,795 R176Q probably damaging Het
Zfp207 T A 11: 80,395,427 Y424* probably null Het
Zfp729a A G 13: 67,619,557 V851A probably benign Het
Zkscan1 G T 5: 138,101,363 A450S probably benign Het
Zkscan3 A G 13: 21,396,446 V24A possibly damaging Het
Other mutations in Spag6l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Spag6l APN 16 16780733 missense probably benign 0.20
IGL00928:Spag6l APN 16 16767013 missense possibly damaging 0.52
IGL00929:Spag6l APN 16 16767013 missense possibly damaging 0.52
IGL01793:Spag6l APN 16 16781857 missense probably damaging 1.00
IGL02380:Spag6l APN 16 16763169 critical splice acceptor site probably null
IGL03271:Spag6l APN 16 16780728 missense probably damaging 1.00
R0284:Spag6l UTSW 16 16780766 missense probably damaging 0.99
R0394:Spag6l UTSW 16 16780629 missense probably benign
R0720:Spag6l UTSW 16 16767096 splice site probably benign
R1205:Spag6l UTSW 16 16787307 missense probably damaging 1.00
R1496:Spag6l UTSW 16 16780614 splice site probably benign
R1707:Spag6l UTSW 16 16780628 missense probably benign 0.00
R2255:Spag6l UTSW 16 16777339 missense probably damaging 0.96
R2330:Spag6l UTSW 16 16829085 missense probably benign
R3755:Spag6l UTSW 16 16763020 critical splice donor site probably null
R3796:Spag6l UTSW 16 16763052 missense probably damaging 1.00
R4093:Spag6l UTSW 16 16829024 missense probably benign 0.05
R4324:Spag6l UTSW 16 16787235 missense probably benign 0.00
R4725:Spag6l UTSW 16 16792531 missense probably damaging 1.00
R4766:Spag6l UTSW 16 16777390 missense probably benign 0.03
R4877:Spag6l UTSW 16 16781758 missense possibly damaging 0.47
R5753:Spag6l UTSW 16 16766967 critical splice donor site probably null
R5958:Spag6l UTSW 16 16763021 critical splice donor site probably null
R6107:Spag6l UTSW 16 16781788 missense possibly damaging 0.56
R6894:Spag6l UTSW 16 16783938 missense probably damaging 1.00
R7329:Spag6l UTSW 16 16767019 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCTCATGTAGAATTTCAAAGTCCAC -3'
(R):5'- TCGGTAGTAAAACTCTAACTTGGG -3'

Sequencing Primer
(F):5'- GCTGCCTTCAGATCAAGATGTAG -3'
(R):5'- GAAAGAAGAAATGTTGTTTTGTGTGC -3'
Posted On2014-07-14