Incidental Mutation 'R1926:Msh6'
ID213485
Institutional Source Beutler Lab
Gene Symbol Msh6
Ensembl Gene ENSMUSG00000005370
Gene NamemutS homolog 6
SynonymsGTBP, Gtmbp, Msh6
MMRRC Submission 039944-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1926 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location87975050-87990883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87986225 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 803 (T803A)
Ref Sequence ENSEMBL: ENSMUSP00000005503 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005503] [ENSMUST00000005504]
Predicted Effect probably benign
Transcript: ENSMUST00000005503
AA Change: T803A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000005503
Gene: ENSMUSG00000005370
AA Change: T803A

DomainStartEndE-ValueType
low complexity region 23 46 N/A INTRINSIC
low complexity region 76 87 N/A INTRINSIC
PWWP 90 152 9.01e-30 SMART
low complexity region 198 212 N/A INTRINSIC
low complexity region 216 230 N/A INTRINSIC
low complexity region 239 264 N/A INTRINSIC
low complexity region 273 291 N/A INTRINSIC
low complexity region 373 389 N/A INTRINSIC
Pfam:MutS_I 406 525 4.7e-35 PFAM
Pfam:MutS_II 536 700 1.4e-10 PFAM
MUTSd 750 1100 4.56e-86 SMART
MUTSac 1125 1319 1.68e-116 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000005504
SMART Domains Protein: ENSMUSP00000005504
Gene: ENSMUSG00000005371

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
low complexity region 21 73 N/A INTRINSIC
FBOX 162 202 2.44e-8 SMART
PbH1 398 420 1.37e3 SMART
PbH1 421 443 8.83e0 SMART
CASH 421 557 1.31e-7 SMART
PbH1 444 466 6.15e1 SMART
PbH1 467 489 1.78e3 SMART
PbH1 490 512 2.29e2 SMART
PbH1 513 535 7.67e2 SMART
PbH1 536 558 1.36e0 SMART
PbH1 559 581 3.59e0 SMART
CASH 573 695 2.35e0 SMART
PbH1 582 604 8.73e2 SMART
PbH1 605 627 4.28e2 SMART
PbH1 628 650 5.03e2 SMART
PbH1 651 673 3.79e1 SMART
PbH1 674 696 4.73e0 SMART
PbH1 697 719 1.86e2 SMART
CASH 711 840 9.31e-13 SMART
PbH1 720 742 2.91e0 SMART
PbH1 743 765 3.73e2 SMART
PbH1 766 788 1.62e2 SMART
PbH1 789 811 9.99e1 SMART
PbH1 812 833 1.21e3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130379
SMART Domains Protein: ENSMUSP00000121206
Gene: ENSMUSG00000005371

DomainStartEndE-ValueType
FBOX 87 127 2.44e-8 SMART
PbH1 323 345 1.37e3 SMART
PbH1 346 368 8.83e0 SMART
CASH 346 482 1.31e-7 SMART
PbH1 369 391 6.15e1 SMART
PbH1 392 414 1.78e3 SMART
PbH1 415 437 2.29e2 SMART
PbH1 438 460 7.67e2 SMART
PbH1 461 483 1.36e0 SMART
PbH1 484 506 3.59e0 SMART
CASH 498 620 2.35e0 SMART
PbH1 507 529 8.73e2 SMART
PbH1 530 552 4.28e2 SMART
PbH1 553 575 5.03e2 SMART
PbH1 576 598 3.79e1 SMART
PbH1 599 621 4.73e0 SMART
PbH1 622 644 1.86e2 SMART
CASH 636 765 9.31e-13 SMART
PbH1 645 667 2.91e0 SMART
PbH1 668 690 3.73e2 SMART
PbH1 691 713 1.62e2 SMART
PbH1 714 736 9.99e1 SMART
PbH1 737 758 1.21e3 SMART
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.7%
  • 10x: 95.0%
  • 20x: 91.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA mismatch repair MutS family. In E. coli, the MutS protein helps in the recognition of mismatched nucleotides prior to their repair. A highly conserved region of approximately 150 aa, called the Walker-A adenine nucleotide binding motif, exists in MutS homologs. The encoded protein heterodimerizes with MSH2 to form a mismatch recognition complex that functions as a bidirectional molecular switch that exchanges ADP and ATP as DNA mismatches are bound and dissociated. Mutations in this gene may be associated with hereditary nonpolyposis colon cancer, colorectal cancer, and endometrial cancer. Transcripts variants encoding different isoforms have been described. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit premature death and are predisposed to tumor formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik C T 6: 149,329,404 T1316I probably benign Het
Acsm3 C T 7: 119,777,136 T362M probably damaging Het
Ang6 A G 14: 44,002,238 V11A possibly damaging Het
Ankrd17 A G 5: 90,244,169 Y1880H probably damaging Het
BC049730 G A 7: 24,714,116 G186R probably damaging Het
Bmi1 A G 2: 18,682,273 I55V probably benign Het
Bnipl G A 3: 95,243,043 T297M probably damaging Het
Bpifa2 T C 2: 154,013,749 V198A probably benign Het
Brms1l G T 12: 55,863,161 V239F possibly damaging Het
Ccdc158 A G 5: 92,650,788 V351A probably benign Het
Ces1c A G 8: 93,127,604 F101S possibly damaging Het
Cpb2 T C 14: 75,242,397 Y15H probably benign Het
Dglucy A T 12: 100,867,155 N535I possibly damaging Het
Dopey1 C A 9: 86,523,019 H1763Q probably damaging Het
Dpy19l1 C T 9: 24,473,824 M236I probably benign Het
Efna2 T C 10: 80,186,876 Y85H probably damaging Het
Eipr1 A T 12: 28,864,837 probably null Het
Eln A T 5: 134,706,567 Y787* probably null Het
Erbb2 G C 11: 98,425,164 E364D probably benign Het
F5 A G 1: 164,179,508 T294A probably damaging Het
Fam47e A G 5: 92,585,385 T194A possibly damaging Het
Galk1 T C 11: 116,010,247 D202G probably damaging Het
Glb1l2 T C 9: 26,771,066 D163G probably damaging Het
Gmip A G 8: 69,815,520 E408G probably benign Het
Gp1ba A T 11: 70,640,889 probably benign Het
Grm3 A T 5: 9,504,881 C804S probably damaging Het
Gzmd A G 14: 56,130,280 C179R probably damaging Het
Hadhb T A 5: 30,180,937 L415Q possibly damaging Het
Ift80 T C 3: 68,916,165 Y588C probably damaging Het
Jazf1 T C 6: 53,068,531 T13A probably benign Het
Kat8 T A 7: 127,915,295 Y67* probably null Het
Kcnab1 G A 3: 65,376,512 E384K possibly damaging Het
Lhx3 A T 2: 26,202,188 Y230* probably null Het
Lmx1b T A 2: 33,564,662 M365L probably damaging Het
Ly6k G T 15: 74,797,202 P76Q probably benign Het
Map1b A T 13: 99,430,692 H1840Q unknown Het
Map3k2 A G 18: 32,203,110 I117V probably damaging Het
Med13 C A 11: 86,289,073 A1350S possibly damaging Het
Midn T C 10: 80,151,661 S109P probably damaging Het
Nckap1 T C 2: 80,506,838 Y1018C probably damaging Het
Ndufc1 A T 3: 51,407,395 N63K probably benign Het
Neb A T 2: 52,279,635 S1811R probably damaging Het
Notch1 T C 2: 26,481,657 D260G probably damaging Het
Ntn4 C T 10: 93,707,353 R314W probably damaging Het
Oas1g T C 5: 120,879,142 K283R probably benign Het
Obscn T C 11: 59,063,474 T4037A possibly damaging Het
Olfr1414 A G 1: 92,511,608 L140P probably damaging Het
Olfr449 T G 6: 42,838,313 L144R probably damaging Het
Otop2 A T 11: 115,326,955 T206S probably benign Het
Pamr1 A G 2: 102,640,997 probably null Het
Pkp1 G A 1: 135,877,673 T675I probably benign Het
Plxna2 G A 1: 194,762,450 V717I probably benign Het
Ptgs2 T C 1: 150,100,228 L2P possibly damaging Het
Rarg A G 15: 102,239,545 F277S probably damaging Het
Rassf5 A T 1: 131,212,339 I161N probably damaging Het
Rxfp4 A G 3: 88,652,352 V264A probably benign Het
Secisbp2l T A 2: 125,740,677 Q953L probably damaging Het
Serpinb9c T C 13: 33,150,235 I275V probably benign Het
Slc2a12 T C 10: 22,665,242 V332A probably damaging Het
Slc7a1 T C 5: 148,348,303 S127G probably damaging Het
Slc7a4 A T 16: 17,575,704 V77E probably damaging Het
Sp8 G A 12: 118,849,229 S273N possibly damaging Het
Spag6l G T 16: 16,763,057 N475K probably benign Het
St18 A G 1: 6,802,689 H216R probably benign Het
Tcirg1 C T 19: 3,902,843 probably benign Het
Tmeff1 A G 4: 48,658,788 Y87C probably damaging Het
Tmem94 T C 11: 115,792,900 V713A possibly damaging Het
Tnrc6b G T 15: 80,881,162 R955L probably damaging Het
Trip12 A G 1: 84,749,291 V1153A probably damaging Het
Tshz3 T C 7: 36,769,375 L263S probably damaging Het
Tubb6 G A 18: 67,401,321 probably null Het
Ube3a T C 7: 59,276,379 W302R probably damaging Het
Vcpkmt A T 12: 69,582,745 V81E probably damaging Het
Vmn1r175 T A 7: 23,809,041 I54F possibly damaging Het
Vwa8 T A 14: 79,020,635 N741K probably benign Het
Yeats2 A G 16: 20,214,426 T1034A probably benign Het
Zc3h6 G A 2: 128,997,795 R176Q probably damaging Het
Zfp207 T A 11: 80,395,427 Y424* probably null Het
Zfp729a A G 13: 67,619,557 V851A probably benign Het
Zkscan1 G T 5: 138,101,363 A450S probably benign Het
Zkscan3 A G 13: 21,396,446 V24A possibly damaging Het
Other mutations in Msh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01691:Msh6 APN 17 87985479 missense probably benign
IGL01834:Msh6 APN 17 87985712 missense probably damaging 1.00
IGL01904:Msh6 APN 17 87984732 missense probably benign
IGL01957:Msh6 APN 17 87985091 missense possibly damaging 0.73
IGL02117:Msh6 APN 17 87990806 unclassified probably benign
IGL02234:Msh6 APN 17 87986801 missense probably damaging 1.00
IGL02512:Msh6 APN 17 87984732 missense probably benign
IGL02651:Msh6 APN 17 87989515 missense probably damaging 1.00
IGL03381:Msh6 APN 17 87985109 missense probably damaging 1.00
medea UTSW 17 87980223 nonsense probably null
medusa UTSW 17 87988463 unclassified probably benign
PIT4449001:Msh6 UTSW 17 87986188 missense probably damaging 0.96
R0196:Msh6 UTSW 17 87980360 missense possibly damaging 0.95
R0324:Msh6 UTSW 17 87986620 nonsense probably null
R0492:Msh6 UTSW 17 87975251 missense probably benign
R0711:Msh6 UTSW 17 87986684 missense probably damaging 1.00
R1065:Msh6 UTSW 17 87988463 unclassified probably benign
R1454:Msh6 UTSW 17 87984758 missense probably benign 0.00
R1740:Msh6 UTSW 17 87985722 missense possibly damaging 0.72
R1770:Msh6 UTSW 17 87980223 nonsense probably null
R1771:Msh6 UTSW 17 87984522 missense probably benign 0.17
R1919:Msh6 UTSW 17 87985125 missense probably benign 0.01
R2026:Msh6 UTSW 17 87990343 missense probably damaging 1.00
R2095:Msh6 UTSW 17 87988233 missense possibly damaging 0.93
R2097:Msh6 UTSW 17 87985416 missense probably benign 0.00
R2149:Msh6 UTSW 17 87986088 missense probably damaging 1.00
R2156:Msh6 UTSW 17 87986140 nonsense probably null
R2167:Msh6 UTSW 17 87989483 missense probably damaging 1.00
R2382:Msh6 UTSW 17 87984731 missense probably benign
R3005:Msh6 UTSW 17 87988285 missense probably benign 0.34
R3160:Msh6 UTSW 17 87985481 missense probably damaging 1.00
R3162:Msh6 UTSW 17 87985481 missense probably damaging 1.00
R3162:Msh6 UTSW 17 87985481 missense probably damaging 1.00
R3774:Msh6 UTSW 17 87986181 missense probably damaging 1.00
R3775:Msh6 UTSW 17 87986181 missense probably damaging 1.00
R4350:Msh6 UTSW 17 87984584 missense probably damaging 1.00
R4424:Msh6 UTSW 17 87990789 nonsense probably null
R4499:Msh6 UTSW 17 87980269 missense probably damaging 1.00
R4667:Msh6 UTSW 17 87984806 missense possibly damaging 0.89
R4668:Msh6 UTSW 17 87984806 missense possibly damaging 0.89
R4669:Msh6 UTSW 17 87984806 missense possibly damaging 0.89
R4849:Msh6 UTSW 17 87983519 missense possibly damaging 0.94
R5137:Msh6 UTSW 17 87980288 missense possibly damaging 0.83
R5472:Msh6 UTSW 17 87984561 missense possibly damaging 0.81
R5594:Msh6 UTSW 17 87986069 missense probably benign 0.00
R5607:Msh6 UTSW 17 87986901 missense probably damaging 1.00
R5608:Msh6 UTSW 17 87986901 missense probably damaging 1.00
R5660:Msh6 UTSW 17 87984719 missense possibly damaging 0.94
R6243:Msh6 UTSW 17 87983571 missense possibly damaging 0.69
R6279:Msh6 UTSW 17 87980249 missense probably damaging 1.00
R6357:Msh6 UTSW 17 87984460 nonsense probably null
R6399:Msh6 UTSW 17 87986891 missense probably damaging 1.00
R6453:Msh6 UTSW 17 87985739 missense probably damaging 1.00
R6646:Msh6 UTSW 17 87986442 missense possibly damaging 0.80
R7404:Msh6 UTSW 17 87975120
X0026:Msh6 UTSW 17 87986181 missense probably damaging 1.00
X0026:Msh6 UTSW 17 87990614 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACCTGGAGATTTTCCTGAATGG -3'
(R):5'- AGAAGCCCTGAGACTTTACAC -3'

Sequencing Primer
(F):5'- TGGGACAAATGGCTCTACTG -3'
(R):5'- CTTTGAATCCTTCTAGAGCAGAGAG -3'
Posted On2014-07-14