Incidental Mutation 'R1937:Tnrc6c'
ID213570
Institutional Source Beutler Lab
Gene Symbol Tnrc6c
Ensembl Gene ENSMUSG00000025571
Gene Nametrinucleotide repeat containing 6C
Synonyms9930033H14Rik
MMRRC Submission 039955-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1937 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location117654289-117763439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117756023 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1450 (D1450G)
Ref Sequence ENSEMBL: ENSMUSP00000115221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026658] [ENSMUST00000106344] [ENSMUST00000138299]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026658
AA Change: D1618G

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000026658
Gene: ENSMUSG00000025571
AA Change: D1618G

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000106344
AA Change: D1618G

PolyPhen 2 Score 0.898 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101951
Gene: ENSMUSG00000025571
AA Change: D1618G

DomainStartEndE-ValueType
coiled coil region 1 32 N/A INTRINSIC
low complexity region 37 58 N/A INTRINSIC
low complexity region 110 132 N/A INTRINSIC
low complexity region 248 257 N/A INTRINSIC
low complexity region 298 318 N/A INTRINSIC
low complexity region 394 408 N/A INTRINSIC
low complexity region 440 457 N/A INTRINSIC
internal_repeat_1 472 573 2.14e-5 PROSPERO
low complexity region 594 614 N/A INTRINSIC
low complexity region 621 632 N/A INTRINSIC
internal_repeat_2 639 704 5.49e-5 PROSPERO
internal_repeat_1 799 902 2.14e-5 PROSPERO
low complexity region 964 981 N/A INTRINSIC
internal_repeat_2 991 1051 5.49e-5 PROSPERO
low complexity region 1063 1079 N/A INTRINSIC
low complexity region 1111 1125 N/A INTRINSIC
UBA 1145 1182 3.68e-4 SMART
Pfam:M_domain 1232 1459 6.8e-77 PFAM
Pfam:TNRC6-PABC_bdg 1468 1646 4.1e-75 PFAM
Pfam:TNRC6-PABC_bdg 1643 1722 3.7e-33 PFAM
RRM 1725 1792 1.81e-2 SMART
low complexity region 1813 1823 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000138299
AA Change: D1450G

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115221
Gene: ENSMUSG00000025571
AA Change: D1450G

DomainStartEndE-ValueType
low complexity region 88 97 N/A INTRINSIC
low complexity region 138 158 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 280 297 N/A INTRINSIC
internal_repeat_1 312 413 9.45e-5 PROSPERO
low complexity region 434 454 N/A INTRINSIC
low complexity region 461 472 N/A INTRINSIC
internal_repeat_1 639 742 9.45e-5 PROSPERO
low complexity region 804 821 N/A INTRINSIC
low complexity region 903 919 N/A INTRINSIC
low complexity region 951 965 N/A INTRINSIC
UBA 985 1022 3.68e-4 SMART
Pfam:M_domain 1036 1293 1.7e-53 PFAM
low complexity region 1397 1406 N/A INTRINSIC
PDB:3KTP|B 1422 1443 7e-7 PDB
low complexity region 1507 1518 N/A INTRINSIC
low complexity region 1531 1552 N/A INTRINSIC
RRM 1557 1624 1.81e-2 SMART
low complexity region 1645 1655 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141115
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141287
Meta Mutation Damage Score 0.21 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit complete neonatal lethality with cyanosis, respiratory distress and thickened mesenchyme in air sacs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,987,163 H17L probably damaging Het
5730480H06Rik C A 5: 48,374,435 T35K probably benign Het
Abhd14a A G 9: 106,440,247 probably benign Het
Abhd8 A G 8: 71,461,862 F41L possibly damaging Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Actr5 T C 2: 158,636,029 Y440H possibly damaging Het
Akr1c6 T A 13: 4,446,384 N81K probably benign Het
Aqp11 T A 7: 97,737,518 N157I possibly damaging Het
Arhgap10 T C 8: 77,344,653 E568G probably damaging Het
Asb7 T A 7: 66,679,253 Q13L probably benign Het
Atf7ip C A 6: 136,560,780 A345E probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bpifb4 A T 2: 153,944,076 I259F probably damaging Het
Cand1 A T 10: 119,203,020 D1218E probably damaging Het
Capg A G 6: 72,558,253 probably null Het
Cep290 C T 10: 100,497,953 T289M possibly damaging Het
Cfap69 T C 5: 5,593,818 Y548C probably damaging Het
Clock A G 5: 76,229,493 L652P probably damaging Het
Col3a1 C T 1: 45,334,293 probably benign Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Crebrf T C 17: 26,742,468 S188P probably damaging Het
Cul1 T C 6: 47,508,355 F307L probably benign Het
Cyb561d2 G A 9: 107,540,316 R79W probably damaging Het
Cyp3a59 T C 5: 146,094,377 S117P possibly damaging Het
Ddias A G 7: 92,858,622 I695T probably benign Het
Dhx29 G A 13: 112,965,330 G1311D probably benign Het
Diexf A T 1: 193,122,093 D200E probably damaging Het
Dync2h1 A G 9: 7,139,159 probably null Het
Ece2 T A 16: 20,617,866 V146E probably damaging Het
Eml2 A G 7: 19,203,964 K586E possibly damaging Het
Eps8l3 A G 3: 107,884,392 E316G probably benign Het
Fam135b A T 15: 71,622,014 L22H probably damaging Het
Fam166b T A 4: 43,427,586 K220N probably damaging Het
Focad T A 4: 88,401,081 M1K probably null Het
Fryl A G 5: 73,133,367 S65P probably damaging Het
Gm14190 C T 11: 99,690,730 C4Y unknown Het
Gm8909 T A 17: 36,168,007 T117S probably damaging Het
Ift74 T A 4: 94,662,646 M345K probably benign Het
Ispd G A 12: 36,390,368 V92I probably benign Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Kcng1 T C 2: 168,263,021 T302A probably benign Het
Kif20b T C 19: 34,952,878 V1221A possibly damaging Het
Kif23 A T 9: 61,946,610 probably null Het
Lpxn T G 19: 12,824,910 S200A probably benign Het
Meiob A G 17: 24,818,331 H61R probably benign Het
Mfhas1 C T 8: 35,589,645 L425F probably damaging Het
Myo3a A T 2: 22,396,315 S632C probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nbeal1 T A 1: 60,267,941 Y374* probably null Het
Notch3 T C 17: 32,153,852 S582G probably benign Het
Nphs1 A T 7: 30,474,373 Q985L probably damaging Het
Oas1c T A 5: 120,802,984 H248L probably benign Het
Olfr154 T C 2: 85,663,997 I146V probably benign Het
Olfr193 A T 16: 59,109,794 M272K probably benign Het
Olfr368 A T 2: 37,331,884 N46Y probably damaging Het
Olfr955 A G 9: 39,470,037 S230P possibly damaging Het
Pamr1 A T 2: 102,642,272 I639F possibly damaging Het
Panx1 G T 9: 15,007,684 T293K possibly damaging Het
Papss1 G T 3: 131,599,871 V226F probably benign Het
Pax1 G T 2: 147,367,889 G301V possibly damaging Het
Pdlim5 C A 3: 142,244,981 R557L possibly damaging Het
Pdyn C A 2: 129,689,809 M20I probably benign Het
Pelp1 G A 11: 70,393,715 probably null Het
Pkd2 T C 5: 104,478,924 V324A probably damaging Het
Pkdrej A G 15: 85,819,167 I856T probably benign Het
Polr1a T C 6: 71,936,552 probably null Het
Pot1a A T 6: 25,753,324 D404E probably benign Het
Ppp2r2a A T 14: 67,016,429 I430N possibly damaging Het
Prob1 C T 18: 35,654,226 R325Q possibly damaging Het
Prrc2a T C 17: 35,157,908 D742G probably damaging Het
Psmc1 C T 12: 100,114,843 P54S probably benign Het
Rab22a A G 2: 173,688,211 T61A probably damaging Het
Rims1 T A 1: 22,288,530 K184N probably damaging Het
Rnf213 G A 11: 119,431,685 R1376H probably damaging Het
Ryr2 T C 13: 11,668,962 E3072G probably damaging Het
Serpina1b T C 12: 103,732,161 K143R probably benign Het
Slc22a15 T G 3: 101,880,189 probably null Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slc25a48 A C 13: 56,448,998 T31P probably damaging Het
Slc9a3 C T 13: 74,166,056 probably null Het
Slx4 T C 16: 3,987,166 *105W probably null Het
Smc6 A G 12: 11,299,398 N794S probably benign Het
Spata18 G A 5: 73,676,964 R387Q probably damaging Het
Sphkap C A 1: 83,267,441 E1486* probably null Het
Srsf6 C T 2: 162,934,483 probably benign Het
St8sia1 C T 6: 142,963,672 A33T probably damaging Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Tmem144 G T 3: 79,825,304 S222R probably damaging Het
Top1 A T 2: 160,670,122 K27N unknown Het
Tox2 A G 2: 163,225,556 H30R probably benign Het
Tra2b T C 16: 22,247,243 probably benign Het
Trio A T 15: 27,833,056 V1165E probably damaging Het
Troap T A 15: 99,077,388 S145R probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttc6 C T 12: 57,616,323 P302S probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ugt2b35 G T 5: 87,001,282 V131F probably damaging Het
Vmn1r167 G A 7: 23,505,027 T188I probably benign Het
Vmn1r46 G T 6: 89,976,734 M188I probably benign Het
Vmn2r115 T A 17: 23,359,414 N620K probably damaging Het
Vmn2r66 A G 7: 84,995,136 S689P probably damaging Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zbtb16 T C 9: 48,659,778 S563G probably benign Het
Zfp319 T C 8: 95,328,571 T335A probably damaging Het
Zfp418 A G 7: 7,182,402 R455G possibly damaging Het
Other mutations in Tnrc6c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00839:Tnrc6c APN 11 117714185 missense possibly damaging 0.91
IGL01013:Tnrc6c APN 11 117722029 missense probably benign 0.44
IGL01092:Tnrc6c APN 11 117721985 missense probably damaging 0.99
IGL01383:Tnrc6c APN 11 117714257 missense probably benign 0.37
IGL01395:Tnrc6c APN 11 117723113 missense probably benign 0.08
IGL01726:Tnrc6c APN 11 117749335 splice site probably benign
IGL01869:Tnrc6c APN 11 117755448 missense possibly damaging 0.65
IGL02108:Tnrc6c APN 11 117721199 missense probably benign 0.29
IGL02457:Tnrc6c APN 11 117722977 missense probably benign 0.28
IGL02612:Tnrc6c APN 11 117743000 missense possibly damaging 0.95
IGL02748:Tnrc6c APN 11 117732170 missense probably benign 0.00
IGL03160:Tnrc6c APN 11 117749825 splice site probably benign
rodion UTSW 11 117738350 critical splice donor site probably null
F5770:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
K3955:Tnrc6c UTSW 11 117760738 missense probably damaging 0.99
R0015:Tnrc6c UTSW 11 117721458 missense probably damaging 0.98
R0143:Tnrc6c UTSW 11 117752985 missense probably damaging 1.00
R0277:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0323:Tnrc6c UTSW 11 117739881 missense probably damaging 1.00
R0464:Tnrc6c UTSW 11 117760549 missense probably damaging 1.00
R0699:Tnrc6c UTSW 11 117722621 missense probably benign 0.02
R1015:Tnrc6c UTSW 11 117721922 missense possibly damaging 0.89
R1201:Tnrc6c UTSW 11 117721674 missense probably damaging 0.96
R1297:Tnrc6c UTSW 11 117733703 missense possibly damaging 0.52
R1560:Tnrc6c UTSW 11 117759637 missense probably damaging 1.00
R1596:Tnrc6c UTSW 11 117758041 missense probably damaging 1.00
R1758:Tnrc6c UTSW 11 117760730 missense probably benign 0.09
R1892:Tnrc6c UTSW 11 117714362 missense probably benign
R1901:Tnrc6c UTSW 11 117723005 missense probably damaging 0.98
R1935:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1936:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R1940:Tnrc6c UTSW 11 117756023 missense possibly damaging 0.91
R3622:Tnrc6c UTSW 11 117749625 missense probably damaging 1.00
R3711:Tnrc6c UTSW 11 117723124 missense probably benign 0.00
R3725:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3775:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3776:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3836:Tnrc6c UTSW 11 117723229 missense probably benign 0.20
R3844:Tnrc6c UTSW 11 117755483 missense probably damaging 1.00
R3852:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3928:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3929:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3937:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R3943:Tnrc6c UTSW 11 117723529 missense probably damaging 0.96
R4501:Tnrc6c UTSW 11 117722498 missense probably damaging 1.00
R4510:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4511:Tnrc6c UTSW 11 117742958 missense possibly damaging 0.68
R4654:Tnrc6c UTSW 11 117720971 missense probably benign
R4765:Tnrc6c UTSW 11 117742927 missense probably benign 0.09
R4824:Tnrc6c UTSW 11 117722905 missense probably damaging 0.98
R5004:Tnrc6c UTSW 11 117721046 missense probably benign 0.44
R5094:Tnrc6c UTSW 11 117721046 missense probably benign 0.00
R5130:Tnrc6c UTSW 11 117738350 critical splice donor site probably null
R5234:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5235:Tnrc6c UTSW 11 117760729 missense probably benign 0.42
R5345:Tnrc6c UTSW 11 117723287 missense possibly damaging 0.80
R5359:Tnrc6c UTSW 11 117758905 splice site silent
R5428:Tnrc6c UTSW 11 117700762 start codon destroyed probably null
R5548:Tnrc6c UTSW 11 117760843 missense possibly damaging 0.96
R5587:Tnrc6c UTSW 11 117749271 nonsense probably null
R5875:Tnrc6c UTSW 11 117759708 missense probably damaging 0.99
R5947:Tnrc6c UTSW 11 117722519 missense probably damaging 1.00
R6135:Tnrc6c UTSW 11 117736005 missense probably damaging 0.97
R6354:Tnrc6c UTSW 11 117749614 missense possibly damaging 0.90
R6389:Tnrc6c UTSW 11 117722741 missense probably damaging 0.99
R7027:Tnrc6c UTSW 11 117733618 missense probably damaging 1.00
R7048:Tnrc6c UTSW 11 117721974 missense probably benign 0.41
R7098:Tnrc6c UTSW 11 117714126 missense probably benign 0.03
R7315:Tnrc6c UTSW 11 117723528 missense probably benign 0.11
V7580:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7581:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7582:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
V7583:Tnrc6c UTSW 11 117723326 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGTCCTGGTTTCTTCCAAAAG -3'
(R):5'- CTCACATAGGCTTGGCTTGG -3'

Sequencing Primer
(F):5'- CCTGGTTTCTTCCAAAAGGATGAAC -3'
(R):5'- GCGTCCTCTGATGCCACAC -3'
Posted On2014-07-14