Incidental Mutation 'R1937:Serpina1b'
ID213576
Institutional Source Beutler Lab
Gene Symbol Serpina1b
Ensembl Gene ENSMUSG00000071178
Gene Nameserine (or cysteine) preptidase inhibitor, clade A, member 1B
SynonymsPI2, D12Ucla2, Spi1-2
MMRRC Submission 039955-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.268) question?
Stock #R1937 (G1)
Quality Score126
Status Not validated
Chromosome12
Chromosomal Location103728156-103830373 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 103732161 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 143 (K143R)
Ref Sequence ENSEMBL: ENSMUSP00000139941 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095450] [ENSMUST00000164454] [ENSMUST00000186166] [ENSMUST00000187220]
Predicted Effect probably benign
Transcript: ENSMUST00000095450
AA Change: K143R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000093101
Gene: ENSMUSG00000071178
AA Change: K143R

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164454
AA Change: K143R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127266
Gene: ENSMUSG00000071178
AA Change: K143R

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186166
AA Change: K143R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000139941
Gene: ENSMUSG00000071178
AA Change: K143R

DomainStartEndE-ValueType
SERPIN 53 410 7.62e-203 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187220
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Targeted disruption of this gene leads to significantly fewer than expected heterozygous and homozygous offspring from heterozygous matings. Homozygotes are healthy with no obvious changes in major organs while heterozygotes show a 30% decrease in serum anti-elastase and anti-chymotrypsin activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,987,163 H17L probably damaging Het
5730480H06Rik C A 5: 48,374,435 T35K probably benign Het
Abhd14a A G 9: 106,440,247 probably benign Het
Abhd8 A G 8: 71,461,862 F41L possibly damaging Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Actr5 T C 2: 158,636,029 Y440H possibly damaging Het
Akr1c6 T A 13: 4,446,384 N81K probably benign Het
Aqp11 T A 7: 97,737,518 N157I possibly damaging Het
Arhgap10 T C 8: 77,344,653 E568G probably damaging Het
Asb7 T A 7: 66,679,253 Q13L probably benign Het
Atf7ip C A 6: 136,560,780 A345E probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bpifb4 A T 2: 153,944,076 I259F probably damaging Het
Cand1 A T 10: 119,203,020 D1218E probably damaging Het
Capg A G 6: 72,558,253 probably null Het
Cep290 C T 10: 100,497,953 T289M possibly damaging Het
Cfap69 T C 5: 5,593,818 Y548C probably damaging Het
Clock A G 5: 76,229,493 L652P probably damaging Het
Col3a1 C T 1: 45,334,293 probably benign Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Crebrf T C 17: 26,742,468 S188P probably damaging Het
Cul1 T C 6: 47,508,355 F307L probably benign Het
Cyb561d2 G A 9: 107,540,316 R79W probably damaging Het
Cyp3a59 T C 5: 146,094,377 S117P possibly damaging Het
Ddias A G 7: 92,858,622 I695T probably benign Het
Dhx29 G A 13: 112,965,330 G1311D probably benign Het
Diexf A T 1: 193,122,093 D200E probably damaging Het
Dync2h1 A G 9: 7,139,159 probably null Het
Ece2 T A 16: 20,617,866 V146E probably damaging Het
Eml2 A G 7: 19,203,964 K586E possibly damaging Het
Eps8l3 A G 3: 107,884,392 E316G probably benign Het
Fam135b A T 15: 71,622,014 L22H probably damaging Het
Fam166b T A 4: 43,427,586 K220N probably damaging Het
Focad T A 4: 88,401,081 M1K probably null Het
Fryl A G 5: 73,133,367 S65P probably damaging Het
Gm14190 C T 11: 99,690,730 C4Y unknown Het
Gm8909 T A 17: 36,168,007 T117S probably damaging Het
Ift74 T A 4: 94,662,646 M345K probably benign Het
Ispd G A 12: 36,390,368 V92I probably benign Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Kcng1 T C 2: 168,263,021 T302A probably benign Het
Kif20b T C 19: 34,952,878 V1221A possibly damaging Het
Kif23 A T 9: 61,946,610 probably null Het
Lpxn T G 19: 12,824,910 S200A probably benign Het
Meiob A G 17: 24,818,331 H61R probably benign Het
Mfhas1 C T 8: 35,589,645 L425F probably damaging Het
Myo3a A T 2: 22,396,315 S632C probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nbeal1 T A 1: 60,267,941 Y374* probably null Het
Notch3 T C 17: 32,153,852 S582G probably benign Het
Nphs1 A T 7: 30,474,373 Q985L probably damaging Het
Oas1c T A 5: 120,802,984 H248L probably benign Het
Olfr154 T C 2: 85,663,997 I146V probably benign Het
Olfr193 A T 16: 59,109,794 M272K probably benign Het
Olfr368 A T 2: 37,331,884 N46Y probably damaging Het
Olfr955 A G 9: 39,470,037 S230P possibly damaging Het
Pamr1 A T 2: 102,642,272 I639F possibly damaging Het
Panx1 G T 9: 15,007,684 T293K possibly damaging Het
Papss1 G T 3: 131,599,871 V226F probably benign Het
Pax1 G T 2: 147,367,889 G301V possibly damaging Het
Pdlim5 C A 3: 142,244,981 R557L possibly damaging Het
Pdyn C A 2: 129,689,809 M20I probably benign Het
Pelp1 G A 11: 70,393,715 probably null Het
Pkd2 T C 5: 104,478,924 V324A probably damaging Het
Pkdrej A G 15: 85,819,167 I856T probably benign Het
Polr1a T C 6: 71,936,552 probably null Het
Pot1a A T 6: 25,753,324 D404E probably benign Het
Ppp2r2a A T 14: 67,016,429 I430N possibly damaging Het
Prob1 C T 18: 35,654,226 R325Q possibly damaging Het
Prrc2a T C 17: 35,157,908 D742G probably damaging Het
Psmc1 C T 12: 100,114,843 P54S probably benign Het
Rab22a A G 2: 173,688,211 T61A probably damaging Het
Rims1 T A 1: 22,288,530 K184N probably damaging Het
Rnf213 G A 11: 119,431,685 R1376H probably damaging Het
Ryr2 T C 13: 11,668,962 E3072G probably damaging Het
Slc22a15 T G 3: 101,880,189 probably null Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slc25a48 A C 13: 56,448,998 T31P probably damaging Het
Slc9a3 C T 13: 74,166,056 probably null Het
Slx4 T C 16: 3,987,166 *105W probably null Het
Smc6 A G 12: 11,299,398 N794S probably benign Het
Spata18 G A 5: 73,676,964 R387Q probably damaging Het
Sphkap C A 1: 83,267,441 E1486* probably null Het
Srsf6 C T 2: 162,934,483 probably benign Het
St8sia1 C T 6: 142,963,672 A33T probably damaging Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Tmem144 G T 3: 79,825,304 S222R probably damaging Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Top1 A T 2: 160,670,122 K27N unknown Het
Tox2 A G 2: 163,225,556 H30R probably benign Het
Tra2b T C 16: 22,247,243 probably benign Het
Trio A T 15: 27,833,056 V1165E probably damaging Het
Troap T A 15: 99,077,388 S145R probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttc6 C T 12: 57,616,323 P302S probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ugt2b35 G T 5: 87,001,282 V131F probably damaging Het
Vmn1r167 G A 7: 23,505,027 T188I probably benign Het
Vmn1r46 G T 6: 89,976,734 M188I probably benign Het
Vmn2r115 T A 17: 23,359,414 N620K probably damaging Het
Vmn2r66 A G 7: 84,995,136 S689P probably damaging Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zbtb16 T C 9: 48,659,778 S563G probably benign Het
Zfp319 T C 8: 95,328,571 T335A probably damaging Het
Zfp418 A G 7: 7,182,402 R455G possibly damaging Het
Other mutations in Serpina1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00544:Serpina1b APN 12 103729296 missense possibly damaging 0.90
IGL00990:Serpina1b APN 12 103728266 missense probably damaging 1.00
IGL01947:Serpina1b APN 12 103729317 missense probably benign 0.00
IGL03258:Serpina1b APN 12 103730396 missense probably benign 0.00
IGL03392:Serpina1b APN 12 103732070 missense possibly damaging 0.53
R2383:Serpina1b UTSW 12 103728280 missense probably benign
R3789:Serpina1b UTSW 12 103729272 missense probably damaging 1.00
R4690:Serpina1b UTSW 12 103732380 missense probably damaging 1.00
R5164:Serpina1b UTSW 12 103732087 missense probably benign 0.01
R5650:Serpina1b UTSW 12 103728435 critical splice acceptor site probably null
R6017:Serpina1b UTSW 12 103729272 missense probably damaging 1.00
R6241:Serpina1b UTSW 12 103729256 unclassified probably null
R6522:Serpina1b UTSW 12 103735037 unclassified probably null
R6745:Serpina1b UTSW 12 103730355 missense possibly damaging 0.60
R6884:Serpina1b UTSW 12 103732453 missense probably benign 0.00
R7053:Serpina1b UTSW 12 103732429 missense possibly damaging 0.93
R7208:Serpina1b UTSW 12 103728294 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AAGAATGTAATTCGCCAGGGC -3'
(R):5'- AGCATTGCCACAGCCTTTG -3'

Sequencing Primer
(F):5'- CGAAAACTGTGTCTTGGTCCAG -3'
(R):5'- TCCCTAGGGAGCAAGGGTG -3'
Posted On2014-07-14