Incidental Mutation 'R1937:Ryr2'
ID213578
Institutional Source Beutler Lab
Gene Symbol Ryr2
Ensembl Gene ENSMUSG00000021313
Gene Nameryanodine receptor 2, cardiac
Synonyms9330127I20Rik
MMRRC Submission 039955-MU
Accession Numbers

Ncbi RefSeq: NM_023868.2; MGI: 99685

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1937 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location11553102-12106945 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 11668962 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 3072 (E3072G)
Ref Sequence ENSEMBL: ENSMUSP00000127991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021750] [ENSMUST00000170156]
Predicted Effect probably damaging
Transcript: ENSMUST00000021750
AA Change: E3072G

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000021750
Gene: ENSMUSG00000021313
AA Change: E3072G

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 454 648 3.1e-65 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 862 952 1.8e-36 PFAM
Pfam:RyR 976 1066 1.1e-32 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2122 2331 1.2e-71 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2700 2790 1.1e-33 PFAM
Pfam:RyR 2820 2904 7.1e-27 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3829 3947 3.1e-36 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.7e-96 PFAM
Pfam:Ion_trans 4710 4877 8e-16 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000170156
AA Change: E3072G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127991
Gene: ENSMUSG00000021313
AA Change: E3072G

DomainStartEndE-ValueType
MIR 110 165 4.19e-2 SMART
MIR 172 217 9.25e-4 SMART
MIR 225 280 1.8e-1 SMART
MIR 286 376 2.22e-24 SMART
Pfam:RYDR_ITPR 451 655 3.5e-73 PFAM
SPRY 670 808 1.56e-30 SMART
Pfam:RyR 861 955 1.4e-33 PFAM
Pfam:RyR 975 1069 9.2e-34 PFAM
SPRY 1098 1221 5.07e-39 SMART
SPRY 1423 1562 7.47e-28 SMART
low complexity region 1643 1653 N/A INTRINSIC
low complexity region 1872 1891 N/A INTRINSIC
Pfam:RYDR_ITPR 2120 2331 3.9e-65 PFAM
low complexity region 2372 2379 N/A INTRINSIC
low complexity region 2416 2426 N/A INTRINSIC
low complexity region 2497 2510 N/A INTRINSIC
Pfam:RyR 2699 2793 1.1e-37 PFAM
Pfam:RyR 2819 2907 9.4e-34 PFAM
PDB:2BCX|B 3580 3609 9e-12 PDB
low complexity region 3700 3720 N/A INTRINSIC
Pfam:RIH_assoc 3825 3958 2.3e-42 PFAM
EFh 4026 4054 1.36e0 SMART
EFh 4061 4089 5.92e1 SMART
low complexity region 4218 4227 N/A INTRINSIC
low complexity region 4256 4273 N/A INTRINSIC
transmembrane domain 4278 4300 N/A INTRINSIC
low complexity region 4309 4317 N/A INTRINSIC
Pfam:RR_TM4-6 4332 4598 5.1e-93 PFAM
Pfam:Ion_trans 4705 4865 9.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221941
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype Strain: 3640298
Lethality: E9-E11
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ryanodine receptor found in cardiac muscle sarcoplasmic reticulum. The encoded protein is one of the components of a calcium channel, composed of a tetramer of the ryanodine receptor proteins and a tetramer of FK506 binding protein 1B proteins, that supplies calcium to cardiac muscle. Mutations in this gene are associated with stress-induced polymorphic ventricular tachycardia and arrhythmogenic right ventricular dysplasia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice show embryonic lethality during organogenesis and altered cardiomyocyte morphology. Homozygotes for a phosphorylation defective allele show decreased susceptibility to myocardial infarction-induced heart failure. Homozygotes for the R420W allele show lymphoid organ hypertrophy. [provided by MGI curators]
Allele List at MGI

All alleles(44) : Targeted(17) Gene trapped(27)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,987,163 H17L probably damaging Het
5730480H06Rik C A 5: 48,374,435 T35K probably benign Het
Abhd14a A G 9: 106,440,247 probably benign Het
Abhd8 A G 8: 71,461,862 F41L possibly damaging Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Actr5 T C 2: 158,636,029 Y440H possibly damaging Het
Akr1c6 T A 13: 4,446,384 N81K probably benign Het
Aqp11 T A 7: 97,737,518 N157I possibly damaging Het
Arhgap10 T C 8: 77,344,653 E568G probably damaging Het
Asb7 T A 7: 66,679,253 Q13L probably benign Het
Atf7ip C A 6: 136,560,780 A345E probably benign Het
Atp8a2 T C 14: 59,860,270 K770E probably benign Het
Bpifb4 A T 2: 153,944,076 I259F probably damaging Het
Cand1 A T 10: 119,203,020 D1218E probably damaging Het
Capg A G 6: 72,558,253 probably null Het
Cep290 C T 10: 100,497,953 T289M possibly damaging Het
Cfap69 T C 5: 5,593,818 Y548C probably damaging Het
Clock A G 5: 76,229,493 L652P probably damaging Het
Col3a1 C T 1: 45,334,293 probably benign Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Crebrf T C 17: 26,742,468 S188P probably damaging Het
Cul1 T C 6: 47,508,355 F307L probably benign Het
Cyb561d2 G A 9: 107,540,316 R79W probably damaging Het
Cyp3a59 T C 5: 146,094,377 S117P possibly damaging Het
Ddias A G 7: 92,858,622 I695T probably benign Het
Dhx29 G A 13: 112,965,330 G1311D probably benign Het
Diexf A T 1: 193,122,093 D200E probably damaging Het
Dync2h1 A G 9: 7,139,159 probably null Het
Ece2 T A 16: 20,617,866 V146E probably damaging Het
Eml2 A G 7: 19,203,964 K586E possibly damaging Het
Eps8l3 A G 3: 107,884,392 E316G probably benign Het
Fam135b A T 15: 71,622,014 L22H probably damaging Het
Fam166b T A 4: 43,427,586 K220N probably damaging Het
Focad T A 4: 88,401,081 M1K probably null Het
Fryl A G 5: 73,133,367 S65P probably damaging Het
Gm14190 C T 11: 99,690,730 C4Y unknown Het
Gm8909 T A 17: 36,168,007 T117S probably damaging Het
Ift74 T A 4: 94,662,646 M345K probably benign Het
Ispd G A 12: 36,390,368 V92I probably benign Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Kcng1 T C 2: 168,263,021 T302A probably benign Het
Kif20b T C 19: 34,952,878 V1221A possibly damaging Het
Kif23 A T 9: 61,946,610 probably null Het
Lpxn T G 19: 12,824,910 S200A probably benign Het
Meiob A G 17: 24,818,331 H61R probably benign Het
Mfhas1 C T 8: 35,589,645 L425F probably damaging Het
Myo3a A T 2: 22,396,315 S632C probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nbeal1 T A 1: 60,267,941 Y374* probably null Het
Notch3 T C 17: 32,153,852 S582G probably benign Het
Nphs1 A T 7: 30,474,373 Q985L probably damaging Het
Oas1c T A 5: 120,802,984 H248L probably benign Het
Olfr154 T C 2: 85,663,997 I146V probably benign Het
Olfr193 A T 16: 59,109,794 M272K probably benign Het
Olfr368 A T 2: 37,331,884 N46Y probably damaging Het
Olfr955 A G 9: 39,470,037 S230P possibly damaging Het
Pamr1 A T 2: 102,642,272 I639F possibly damaging Het
Panx1 G T 9: 15,007,684 T293K possibly damaging Het
Papss1 G T 3: 131,599,871 V226F probably benign Het
Pax1 G T 2: 147,367,889 G301V possibly damaging Het
Pdlim5 C A 3: 142,244,981 R557L possibly damaging Het
Pdyn C A 2: 129,689,809 M20I probably benign Het
Pelp1 G A 11: 70,393,715 probably null Het
Pkd2 T C 5: 104,478,924 V324A probably damaging Het
Pkdrej A G 15: 85,819,167 I856T probably benign Het
Polr1a T C 6: 71,936,552 probably null Het
Pot1a A T 6: 25,753,324 D404E probably benign Het
Ppp2r2a A T 14: 67,016,429 I430N possibly damaging Het
Prob1 C T 18: 35,654,226 R325Q possibly damaging Het
Prrc2a T C 17: 35,157,908 D742G probably damaging Het
Psmc1 C T 12: 100,114,843 P54S probably benign Het
Rab22a A G 2: 173,688,211 T61A probably damaging Het
Rims1 T A 1: 22,288,530 K184N probably damaging Het
Rnf213 G A 11: 119,431,685 R1376H probably damaging Het
Serpina1b T C 12: 103,732,161 K143R probably benign Het
Slc22a15 T G 3: 101,880,189 probably null Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slc25a48 A C 13: 56,448,998 T31P probably damaging Het
Slc9a3 C T 13: 74,166,056 probably null Het
Slx4 T C 16: 3,987,166 *105W probably null Het
Smc6 A G 12: 11,299,398 N794S probably benign Het
Spata18 G A 5: 73,676,964 R387Q probably damaging Het
Sphkap C A 1: 83,267,441 E1486* probably null Het
Srsf6 C T 2: 162,934,483 probably benign Het
St8sia1 C T 6: 142,963,672 A33T probably damaging Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Tmem144 G T 3: 79,825,304 S222R probably damaging Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Top1 A T 2: 160,670,122 K27N unknown Het
Tox2 A G 2: 163,225,556 H30R probably benign Het
Tra2b T C 16: 22,247,243 probably benign Het
Trio A T 15: 27,833,056 V1165E probably damaging Het
Troap T A 15: 99,077,388 S145R probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttc6 C T 12: 57,616,323 P302S probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ugt2b35 G T 5: 87,001,282 V131F probably damaging Het
Vmn1r167 G A 7: 23,505,027 T188I probably benign Het
Vmn1r46 G T 6: 89,976,734 M188I probably benign Het
Vmn2r115 T A 17: 23,359,414 N620K probably damaging Het
Vmn2r66 A G 7: 84,995,136 S689P probably damaging Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zbtb16 T C 9: 48,659,778 S563G probably benign Het
Zfp319 T C 8: 95,328,571 T335A probably damaging Het
Zfp418 A G 7: 7,182,402 R455G possibly damaging Het
Other mutations in Ryr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00518:Ryr2 APN 13 11834092 splice site probably benign
IGL00757:Ryr2 APN 13 11618604 splice site probably null
IGL00838:Ryr2 APN 13 11568503 missense probably damaging 0.98
IGL00849:Ryr2 APN 13 11585478 missense possibly damaging 0.91
IGL00987:Ryr2 APN 13 11735502 missense probably damaging 0.99
IGL01096:Ryr2 APN 13 11703544 missense probably damaging 1.00
IGL01313:Ryr2 APN 13 11638485 critical splice acceptor site probably null
IGL01349:Ryr2 APN 13 11587239 missense possibly damaging 0.93
IGL01391:Ryr2 APN 13 11556685 missense possibly damaging 0.96
IGL01401:Ryr2 APN 13 11591352 missense possibly damaging 0.80
IGL01412:Ryr2 APN 13 11742036 missense probably benign 0.10
IGL01419:Ryr2 APN 13 11799837 missense possibly damaging 0.51
IGL01432:Ryr2 APN 13 11851204 missense possibly damaging 0.63
IGL01533:Ryr2 APN 13 11721790 missense probably damaging 1.00
IGL01571:Ryr2 APN 13 11721761 missense probably damaging 1.00
IGL01584:Ryr2 APN 13 11601758 critical splice donor site probably null
IGL01611:Ryr2 APN 13 11591316 missense possibly damaging 0.67
IGL01632:Ryr2 APN 13 11594968 missense probably damaging 0.97
IGL01643:Ryr2 APN 13 11692677 missense possibly damaging 0.94
IGL01647:Ryr2 APN 13 11585480 missense probably damaging 1.00
IGL01730:Ryr2 APN 13 11601842 missense possibly damaging 0.86
IGL01834:Ryr2 APN 13 11595425 missense possibly damaging 0.71
IGL01921:Ryr2 APN 13 11554550 missense possibly damaging 0.96
IGL01937:Ryr2 APN 13 11790363 missense probably damaging 1.00
IGL01945:Ryr2 APN 13 11790363 missense probably damaging 1.00
IGL02027:Ryr2 APN 13 11597112 missense probably damaging 1.00
IGL02060:Ryr2 APN 13 11747564 missense probably damaging 1.00
IGL02065:Ryr2 APN 13 11572257 missense possibly damaging 0.92
IGL02084:Ryr2 APN 13 11792762 nonsense probably null
IGL02086:Ryr2 APN 13 11735556 missense probably damaging 1.00
IGL02095:Ryr2 APN 13 11759759 missense probably damaging 0.98
IGL02100:Ryr2 APN 13 11737873 missense possibly damaging 0.92
IGL02122:Ryr2 APN 13 11741869 missense probably damaging 1.00
IGL02202:Ryr2 APN 13 11730388 missense probably damaging 0.97
IGL02202:Ryr2 APN 13 11747658 splice site probably benign
IGL02369:Ryr2 APN 13 11619496 missense possibly damaging 0.68
IGL02383:Ryr2 APN 13 11722721 splice site probably benign
IGL02400:Ryr2 APN 13 11605244 splice site probably benign
IGL02423:Ryr2 APN 13 11745198 missense probably damaging 1.00
IGL02425:Ryr2 APN 13 11745674 missense probably damaging 0.99
IGL02458:Ryr2 APN 13 11705699 missense probably benign 0.15
IGL02602:Ryr2 APN 13 11554511 utr 3 prime probably benign
IGL02694:Ryr2 APN 13 11605189 missense probably damaging 1.00
IGL02726:Ryr2 APN 13 11738320 missense probably damaging 1.00
IGL02747:Ryr2 APN 13 11655677 missense probably damaging 1.00
IGL02795:Ryr2 APN 13 11595190 missense probably benign 0.21
IGL02876:Ryr2 APN 13 11707793 missense probably benign 0.39
IGL02878:Ryr2 APN 13 11918319 missense probably benign 0.10
IGL02887:Ryr2 APN 13 11591269 missense probably damaging 0.97
IGL02926:Ryr2 APN 13 11759835 missense probably damaging 0.99
IGL03030:Ryr2 APN 13 11684479 missense probably damaging 0.99
IGL03064:Ryr2 APN 13 11643902 critical splice acceptor site probably null
IGL03102:Ryr2 APN 13 11635582 splice site probably benign
IGL03152:Ryr2 APN 13 11853150 missense probably damaging 1.00
IGL03176:Ryr2 APN 13 11742023 nonsense probably null
IGL03180:Ryr2 APN 13 11568563 missense possibly damaging 0.95
IGL03213:Ryr2 APN 13 11724387 splice site probably benign
IGL03390:Ryr2 APN 13 11772416 missense probably benign
IGL03410:Ryr2 APN 13 11588147 missense probably damaging 0.99
Arruda UTSW 13 11643895 missense probably damaging 1.00
arruda2 UTSW 13 11879496 missense probably damaging 1.00
arruda3 UTSW 13 11555448 missense possibly damaging 0.91
H8562:Ryr2 UTSW 13 11717141 splice site probably benign
IGL02799:Ryr2 UTSW 13 11665962 missense probably damaging 1.00
IGL02991:Ryr2 UTSW 13 11761306 missense probably damaging 0.99
PIT4142001:Ryr2 UTSW 13 11707796 missense probably damaging 0.97
PIT4260001:Ryr2 UTSW 13 11594755 missense possibly damaging 0.93
PIT4458001:Ryr2 UTSW 13 11555448 missense probably benign 0.29
R0003:Ryr2 UTSW 13 11824379 missense probably damaging 1.00
R0004:Ryr2 UTSW 13 11665919 missense probably benign
R0018:Ryr2 UTSW 13 11595223 missense possibly damaging 0.94
R0048:Ryr2 UTSW 13 11595784 missense probably damaging 1.00
R0048:Ryr2 UTSW 13 11595784 missense probably damaging 1.00
R0056:Ryr2 UTSW 13 11669038 missense probably damaging 0.97
R0062:Ryr2 UTSW 13 11869116 critical splice donor site probably null
R0062:Ryr2 UTSW 13 11869116 critical splice donor site probably null
R0080:Ryr2 UTSW 13 11568475 missense probably damaging 0.98
R0116:Ryr2 UTSW 13 11709921 missense probably damaging 1.00
R0148:Ryr2 UTSW 13 11714548 missense probably damaging 1.00
R0206:Ryr2 UTSW 13 11676251 splice site probably benign
R0226:Ryr2 UTSW 13 11772556 missense probably damaging 1.00
R0285:Ryr2 UTSW 13 11716977 missense probably damaging 1.00
R0365:Ryr2 UTSW 13 11668839 missense possibly damaging 0.90
R0401:Ryr2 UTSW 13 11705684 missense probably benign 0.45
R0415:Ryr2 UTSW 13 11869156 missense probably damaging 0.97
R0418:Ryr2 UTSW 13 11834095 splice site probably benign
R0558:Ryr2 UTSW 13 11638443 missense probably damaging 1.00
R0558:Ryr2 UTSW 13 11799861 missense probably damaging 1.00
R0574:Ryr2 UTSW 13 11731669 missense probably benign 0.02
R0586:Ryr2 UTSW 13 11635559 missense probably null
R0601:Ryr2 UTSW 13 11705633 critical splice donor site probably null
R0610:Ryr2 UTSW 13 11622952 missense probably damaging 1.00
R0648:Ryr2 UTSW 13 11724333 missense possibly damaging 0.86
R0727:Ryr2 UTSW 13 11566885 missense probably damaging 1.00
R0743:Ryr2 UTSW 13 11554529 missense probably damaging 0.99
R0821:Ryr2 UTSW 13 11738126 missense probably benign 0.35
R0884:Ryr2 UTSW 13 11554529 missense probably damaging 0.99
R1104:Ryr2 UTSW 13 11669969 missense probably damaging 0.99
R1114:Ryr2 UTSW 13 11945981 missense probably damaging 0.98
R1167:Ryr2 UTSW 13 11660113 missense possibly damaging 0.94
R1238:Ryr2 UTSW 13 11759703 missense probably damaging 1.00
R1239:Ryr2 UTSW 13 11883043 critical splice donor site probably null
R1296:Ryr2 UTSW 13 11687879 splice site probably benign
R1400:Ryr2 UTSW 13 11595076 missense probably benign 0.08
R1439:Ryr2 UTSW 13 11714503 splice site probably benign
R1443:Ryr2 UTSW 13 11779266 missense probably benign 0.19
R1446:Ryr2 UTSW 13 11738149 missense probably benign 0.09
R1458:Ryr2 UTSW 13 11727022 missense probably damaging 0.97
R1497:Ryr2 UTSW 13 11601841 missense probably damaging 0.99
R1505:Ryr2 UTSW 13 11554592 missense possibly damaging 0.84
R1548:Ryr2 UTSW 13 11554549 nonsense probably null
R1551:Ryr2 UTSW 13 11785143 critical splice acceptor site probably null
R1567:Ryr2 UTSW 13 11759677 missense possibly damaging 0.87
R1581:Ryr2 UTSW 13 11794563 missense probably benign 0.01
R1645:Ryr2 UTSW 13 11718482 nonsense probably null
R1686:Ryr2 UTSW 13 11603779 splice site probably benign
R1696:Ryr2 UTSW 13 11731657 missense probably benign 0.02
R1708:Ryr2 UTSW 13 11587442 splice site probably null
R1728:Ryr2 UTSW 13 11587422 missense possibly damaging 0.94
R1745:Ryr2 UTSW 13 11790267 missense probably damaging 1.00
R1771:Ryr2 UTSW 13 11745176 critical splice donor site probably null
R1776:Ryr2 UTSW 13 11745176 critical splice donor site probably null
R1783:Ryr2 UTSW 13 11700371 nonsense probably null
R1801:Ryr2 UTSW 13 11595281 missense probably benign 0.01
R1812:Ryr2 UTSW 13 11560586 missense probably damaging 0.97
R1820:Ryr2 UTSW 13 11587316 missense probably damaging 0.99
R1835:Ryr2 UTSW 13 11769878 missense probably benign 0.06
R1868:Ryr2 UTSW 13 11731700 missense probably benign 0.02
R1869:Ryr2 UTSW 13 11662075 missense probably damaging 0.98
R1884:Ryr2 UTSW 13 11738356 missense probably damaging 0.97
R1892:Ryr2 UTSW 13 11658958 nonsense probably null
R1897:Ryr2 UTSW 13 11750932 missense probably benign 0.09
R1899:Ryr2 UTSW 13 11591336 missense probably benign
R1909:Ryr2 UTSW 13 11700349 missense probably damaging 1.00
R1918:Ryr2 UTSW 13 11556698 missense possibly damaging 0.91
R1943:Ryr2 UTSW 13 11731723 missense probably benign 0.10
R1956:Ryr2 UTSW 13 11681080 missense probably damaging 1.00
R1983:Ryr2 UTSW 13 11585402 splice site probably null
R2018:Ryr2 UTSW 13 11851188 missense possibly damaging 0.59
R2019:Ryr2 UTSW 13 11851188 missense possibly damaging 0.59
R2060:Ryr2 UTSW 13 11595736 missense probably damaging 1.00
R2061:Ryr2 UTSW 13 11665878 splice site probably null
R2088:Ryr2 UTSW 13 11662229 missense probably benign 0.04
R2089:Ryr2 UTSW 13 11945977 missense probably benign 0.23
R2091:Ryr2 UTSW 13 11945977 missense probably benign 0.23
R2091:Ryr2 UTSW 13 11945977 missense probably benign 0.23
R2127:Ryr2 UTSW 13 11712195 missense probably damaging 1.00
R2140:Ryr2 UTSW 13 11560607 missense probably damaging 1.00
R2153:Ryr2 UTSW 13 11577873 missense possibly damaging 0.86
R2179:Ryr2 UTSW 13 11705793 nonsense probably null
R2207:Ryr2 UTSW 13 11810937 missense probably damaging 1.00
R2237:Ryr2 UTSW 13 11662260 missense probably benign 0.18
R2258:Ryr2 UTSW 13 11738216 missense possibly damaging 0.94
R2312:Ryr2 UTSW 13 11738242 missense probably damaging 1.00
R2421:Ryr2 UTSW 13 11591237 missense probably damaging 0.98
R2438:Ryr2 UTSW 13 11801848 missense probably damaging 1.00
R2483:Ryr2 UTSW 13 11759703 missense probably damaging 1.00
R2860:Ryr2 UTSW 13 11593093 missense probably damaging 0.98
R2861:Ryr2 UTSW 13 11593093 missense probably damaging 0.98
R2867:Ryr2 UTSW 13 11761349 missense probably damaging 1.00
R2867:Ryr2 UTSW 13 11761349 missense probably damaging 1.00
R3618:Ryr2 UTSW 13 11772580 critical splice acceptor site probably null
R3876:Ryr2 UTSW 13 11588159 missense probably damaging 0.99
R3906:Ryr2 UTSW 13 11738209 missense possibly damaging 0.87
R3912:Ryr2 UTSW 13 11772427 missense probably damaging 0.99
R4018:Ryr2 UTSW 13 11918414 missense probably damaging 1.00
R4114:Ryr2 UTSW 13 11692682 missense probably damaging 1.00
R4119:Ryr2 UTSW 13 11779267 missense probably benign 0.22
R4127:Ryr2 UTSW 13 11587437 missense possibly damaging 0.91
R4222:Ryr2 UTSW 13 11737873 missense possibly damaging 0.92
R4233:Ryr2 UTSW 13 11750725 missense probably benign 0.20
R4355:Ryr2 UTSW 13 11649812 missense probably benign 0.05
R4384:Ryr2 UTSW 13 11605233 missense probably damaging 0.99
R4422:Ryr2 UTSW 13 11717066 nonsense probably null
R4430:Ryr2 UTSW 13 11735527 missense probably damaging 0.98
R4624:Ryr2 UTSW 13 12106415 missense possibly damaging 0.47
R4663:Ryr2 UTSW 13 11749509 missense possibly damaging 0.47
R4665:Ryr2 UTSW 13 11750685 splice site probably null
R4668:Ryr2 UTSW 13 11593117 missense probably benign
R4677:Ryr2 UTSW 13 11706667 missense probably damaging 0.98
R4679:Ryr2 UTSW 13 11824369 missense probably benign 0.34
R4680:Ryr2 UTSW 13 11595233 missense probably benign 0.04
R4685:Ryr2 UTSW 13 11692646 missense probably damaging 1.00
R4709:Ryr2 UTSW 13 11716998 missense probably damaging 1.00
R4731:Ryr2 UTSW 13 11577909 missense possibly damaging 0.53
R4732:Ryr2 UTSW 13 11577909 missense possibly damaging 0.53
R4733:Ryr2 UTSW 13 11577909 missense possibly damaging 0.53
R4734:Ryr2 UTSW 13 11737753 missense probably damaging 0.99
R4740:Ryr2 UTSW 13 11657047 missense possibly damaging 0.95
R4801:Ryr2 UTSW 13 11708227 missense probably damaging 1.00
R4801:Ryr2 UTSW 13 11687932 missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11687932 missense probably damaging 1.00
R4802:Ryr2 UTSW 13 11708227 missense probably damaging 1.00
R4804:Ryr2 UTSW 13 11717097 missense probably damaging 1.00
R4811:Ryr2 UTSW 13 11655698 missense probably damaging 0.97
R4850:Ryr2 UTSW 13 11668820 missense probably damaging 0.99
R4850:Ryr2 UTSW 13 11745752 missense probably damaging 1.00
R4880:Ryr2 UTSW 13 11752218 missense probably damaging 1.00
R4917:Ryr2 UTSW 13 11594986 missense probably damaging 0.96
R4918:Ryr2 UTSW 13 11594986 missense probably damaging 0.96
R4922:Ryr2 UTSW 13 11709963 missense probably damaging 0.99
R4933:Ryr2 UTSW 13 11945945 missense probably damaging 0.96
R4950:Ryr2 UTSW 13 11742011 missense probably damaging 1.00
R4957:Ryr2 UTSW 13 11785080 missense probably damaging 0.97
R4964:Ryr2 UTSW 13 11714611 missense possibly damaging 0.49
R4964:Ryr2 UTSW 13 11833992 missense probably benign 0.00
R4966:Ryr2 UTSW 13 11714611 missense possibly damaging 0.49
R4966:Ryr2 UTSW 13 11833992 missense probably benign 0.00
R4997:Ryr2 UTSW 13 11595306 missense probably benign 0.09
R4998:Ryr2 UTSW 13 11643895 missense probably damaging 1.00
R5033:Ryr2 UTSW 13 11587254 missense possibly damaging 0.93
R5061:Ryr2 UTSW 13 11635536 missense possibly damaging 0.74
R5062:Ryr2 UTSW 13 11700354 missense probably damaging 0.97
R5088:Ryr2 UTSW 13 11712243 nonsense probably null
R5135:Ryr2 UTSW 13 11662130 missense probably benign 0.05
R5138:Ryr2 UTSW 13 11660289 missense probably damaging 1.00
R5168:Ryr2 UTSW 13 11752321 missense probably benign
R5187:Ryr2 UTSW 13 11772452 missense probably damaging 0.99
R5197:Ryr2 UTSW 13 11638430 critical splice donor site probably null
R5262:Ryr2 UTSW 13 11772437 missense probably damaging 0.99
R5325:Ryr2 UTSW 13 11690363 missense probably damaging 0.97
R5381:Ryr2 UTSW 13 11556658 missense probably damaging 1.00
R5437:Ryr2 UTSW 13 11655713 missense probably damaging 1.00
R5477:Ryr2 UTSW 13 11705656 missense probably damaging 1.00
R5497:Ryr2 UTSW 13 11705701 missense probably null 0.15
R5509:Ryr2 UTSW 13 11745601 missense probably damaging 0.98
R5518:Ryr2 UTSW 13 11687909 missense probably benign 0.01
R5571:Ryr2 UTSW 13 11555448 missense possibly damaging 0.91
R5591:Ryr2 UTSW 13 11595014 missense probably benign 0.06
R5619:Ryr2 UTSW 13 11708202 missense probably damaging 1.00
R5630:Ryr2 UTSW 13 11601805 missense probably damaging 1.00
R5644:Ryr2 UTSW 13 11595582 missense probably damaging 0.99
R5667:Ryr2 UTSW 13 11759836 missense probably damaging 1.00
R5775:Ryr2 UTSW 13 11769962 missense probably damaging 1.00
R5836:Ryr2 UTSW 13 11603732 missense probably damaging 1.00
R5858:Ryr2 UTSW 13 11560574 missense probably damaging 0.99
R5934:Ryr2 UTSW 13 11584154 missense probably damaging 0.96
R5939:Ryr2 UTSW 13 11790332 missense probably damaging 0.99
R5941:Ryr2 UTSW 13 11687902 missense probably damaging 1.00
R5945:Ryr2 UTSW 13 11660122 missense probably damaging 1.00
R5946:Ryr2 UTSW 13 11726953 missense probably damaging 1.00
R5966:Ryr2 UTSW 13 11662238 nonsense probably null
R5974:Ryr2 UTSW 13 11714511 splice site probably null
R6104:Ryr2 UTSW 13 11799825 missense probably damaging 1.00
R6118:Ryr2 UTSW 13 11792689 missense possibly damaging 0.69
R6149:Ryr2 UTSW 13 11669017 missense probably benign
R6208:Ryr2 UTSW 13 11895220 missense probably benign 0.04
R6217:Ryr2 UTSW 13 11834078 missense probably damaging 1.00
R6230:Ryr2 UTSW 13 11660107 missense probably damaging 0.99
R6279:Ryr2 UTSW 13 11680999 missense probably damaging 0.97
R6294:Ryr2 UTSW 13 11879496 missense probably damaging 1.00
R6300:Ryr2 UTSW 13 11680999 missense probably damaging 0.97
R6350:Ryr2 UTSW 13 11761396 missense probably damaging 0.98
R6484:Ryr2 UTSW 13 11662383 missense possibly damaging 0.90
R6489:Ryr2 UTSW 13 11834007 missense probably benign 0.29
R6548:Ryr2 UTSW 13 11668821 missense probably damaging 1.00
R6591:Ryr2 UTSW 13 11594723 missense probably benign 0.01
R6623:Ryr2 UTSW 13 11710065 missense probably damaging 1.00
R6649:Ryr2 UTSW 13 11595643 missense probably damaging 0.99
R6691:Ryr2 UTSW 13 11594723 missense probably benign 0.01
R6770:Ryr2 UTSW 13 11738462 missense probably damaging 1.00
R6802:Ryr2 UTSW 13 11686966 missense probably damaging 1.00
R6809:Ryr2 UTSW 13 11726930 missense probably damaging 1.00
R6893:Ryr2 UTSW 13 11829654 missense possibly damaging 0.75
R6911:Ryr2 UTSW 13 11827559 missense possibly damaging 0.50
R6915:Ryr2 UTSW 13 11745601 missense probably damaging 1.00
R6943:Ryr2 UTSW 13 11566948 missense possibly damaging 0.92
R6960:Ryr2 UTSW 13 11801243 missense probably benign 0.28
R6997:Ryr2 UTSW 13 11654380 missense possibly damaging 0.88
R6998:Ryr2 UTSW 13 11712166 missense probably damaging 0.99
R7001:Ryr2 UTSW 13 11794605 missense probably damaging 0.98
R7047:Ryr2 UTSW 13 11824400 missense possibly damaging 0.64
R7089:Ryr2 UTSW 13 11649776 missense probably benign 0.10
R7125:Ryr2 UTSW 13 11669987 missense probably damaging 0.99
R7127:Ryr2 UTSW 13 11655713 missense probably damaging 1.00
R7131:Ryr2 UTSW 13 11640327 missense possibly damaging 0.63
R7131:Ryr2 UTSW 13 11668811 critical splice donor site probably null
R7159:Ryr2 UTSW 13 11810908 missense probably damaging 0.99
R7174:Ryr2 UTSW 13 11801177 missense possibly damaging 0.81
R7180:Ryr2 UTSW 13 11686978 missense probably damaging 1.00
R7182:Ryr2 UTSW 13 11759757 missense probably benign
R7189:Ryr2 UTSW 13 11883123 missense probably damaging 1.00
R7241:Ryr2 UTSW 13 11665913 missense possibly damaging 0.71
R7244:Ryr2 UTSW 13 11597146 missense probably damaging 1.00
S24628:Ryr2 UTSW 13 11869156 missense probably damaging 0.97
X0019:Ryr2 UTSW 13 11703501 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- CAAAAGCCCATTGGGATGAC -3'
(R):5'- CTACTGTAGTGGAGAGGTAGCAC -3'

Sequencing Primer
(F):5'- CCTGATGGTCCTAATTCAAAAGGCAG -3'
(R):5'- TAGCACAGTGGTGGGGGAC -3'
Posted On2014-07-14