Incidental Mutation 'R1937:Atp8a2'
ID213586
Institutional Source Beutler Lab
Gene Symbol Atp8a2
Ensembl Gene ENSMUSG00000021983
Gene NameATPase, aminophospholipid transporter-like, class I, type 8A, member 2
Synonymswl, Ib
MMRRC Submission 039955-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R1937 (G1)
Quality Score189
Status Not validated
Chromosome14
Chromosomal Location59638540-60197179 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59860270 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 770 (K770E)
Ref Sequence ENSEMBL: ENSMUSP00000079238 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080368]
Predicted Effect probably benign
Transcript: ENSMUST00000080368
AA Change: K770E

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000079238
Gene: ENSMUSG00000021983
AA Change: K770E

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 14 80 2.3e-27 PFAM
Pfam:E1-E2_ATPase 85 348 6.7e-15 PFAM
Pfam:HAD 385 790 3.2e-22 PFAM
Pfam:Cation_ATPase 465 564 3.2e-14 PFAM
Pfam:PhoLip_ATPase_C 807 1059 2.8e-79 PFAM
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.7%
  • 20x: 93.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the P4 ATPase family of proteins, which are thought to be involved in a process called lipid flipping, whereby phospholipids are translocated inwards from the exoplasmic leaflet to the cytosolic leaflet of the cell membrane, which aids in generating and maintaining asymmetry in membrane lipids. This protein is predicted to contain an E1 E2 ATPase, a haloacid dehalogenase-like hydrolase (HAD) domain, and multiple transmembrane domains. Associations between this protein and cell cycle control protein 50A are important for translocation of phosphatidylserine across membranes. Mutations in this gene have been associated with cerebellar ataxia, mental retardation and disequilibrium syndrome (CAMRQ). In addition, a translocation breakpoint within this gene was observed in an individual with neurological dysfunction. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygotes for spontaneous mutations have abnormal gait and tremors, with axonal degeneration in central and peripheral neurons. Symptoms progress to immobility and death by 1-month of age. Heterozygotes show subtle locomotor abnormalities and are hyporesponsive to tail pinching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700006E09Rik A T 11: 101,987,163 H17L probably damaging Het
5730480H06Rik C A 5: 48,374,435 T35K probably benign Het
Abhd14a A G 9: 106,440,247 probably benign Het
Abhd8 A G 8: 71,461,862 F41L possibly damaging Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Actr5 T C 2: 158,636,029 Y440H possibly damaging Het
Akr1c6 T A 13: 4,446,384 N81K probably benign Het
Aqp11 T A 7: 97,737,518 N157I possibly damaging Het
Arhgap10 T C 8: 77,344,653 E568G probably damaging Het
Asb7 T A 7: 66,679,253 Q13L probably benign Het
Atf7ip C A 6: 136,560,780 A345E probably benign Het
Bpifb4 A T 2: 153,944,076 I259F probably damaging Het
Cand1 A T 10: 119,203,020 D1218E probably damaging Het
Capg A G 6: 72,558,253 probably null Het
Cep290 C T 10: 100,497,953 T289M possibly damaging Het
Cfap69 T C 5: 5,593,818 Y548C probably damaging Het
Clock A G 5: 76,229,493 L652P probably damaging Het
Col3a1 C T 1: 45,334,293 probably benign Het
Coro7 T C 16: 4,628,732 E843G probably benign Het
Crebrf T C 17: 26,742,468 S188P probably damaging Het
Cul1 T C 6: 47,508,355 F307L probably benign Het
Cyb561d2 G A 9: 107,540,316 R79W probably damaging Het
Cyp3a59 T C 5: 146,094,377 S117P possibly damaging Het
Ddias A G 7: 92,858,622 I695T probably benign Het
Dhx29 G A 13: 112,965,330 G1311D probably benign Het
Diexf A T 1: 193,122,093 D200E probably damaging Het
Dync2h1 A G 9: 7,139,159 probably null Het
Ece2 T A 16: 20,617,866 V146E probably damaging Het
Eml2 A G 7: 19,203,964 K586E possibly damaging Het
Eps8l3 A G 3: 107,884,392 E316G probably benign Het
Fam135b A T 15: 71,622,014 L22H probably damaging Het
Fam166b T A 4: 43,427,586 K220N probably damaging Het
Focad T A 4: 88,401,081 M1K probably null Het
Fryl A G 5: 73,133,367 S65P probably damaging Het
Gm14190 C T 11: 99,690,730 C4Y unknown Het
Gm8909 T A 17: 36,168,007 T117S probably damaging Het
Ift74 T A 4: 94,662,646 M345K probably benign Het
Ispd G A 12: 36,390,368 V92I probably benign Het
Jag1 C G 2: 137,083,473 V1070L possibly damaging Het
Kcng1 T C 2: 168,263,021 T302A probably benign Het
Kif20b T C 19: 34,952,878 V1221A possibly damaging Het
Kif23 A T 9: 61,946,610 probably null Het
Lpxn T G 19: 12,824,910 S200A probably benign Het
Meiob A G 17: 24,818,331 H61R probably benign Het
Mfhas1 C T 8: 35,589,645 L425F probably damaging Het
Myo3a A T 2: 22,396,315 S632C probably damaging Het
Naip2 T C 13: 100,161,854 E558G probably benign Het
Naip2 C T 13: 100,161,860 G556D probably benign Het
Nbeal1 T A 1: 60,267,941 Y374* probably null Het
Notch3 T C 17: 32,153,852 S582G probably benign Het
Nphs1 A T 7: 30,474,373 Q985L probably damaging Het
Oas1c T A 5: 120,802,984 H248L probably benign Het
Olfr154 T C 2: 85,663,997 I146V probably benign Het
Olfr193 A T 16: 59,109,794 M272K probably benign Het
Olfr368 A T 2: 37,331,884 N46Y probably damaging Het
Olfr955 A G 9: 39,470,037 S230P possibly damaging Het
Pamr1 A T 2: 102,642,272 I639F possibly damaging Het
Panx1 G T 9: 15,007,684 T293K possibly damaging Het
Papss1 G T 3: 131,599,871 V226F probably benign Het
Pax1 G T 2: 147,367,889 G301V possibly damaging Het
Pdlim5 C A 3: 142,244,981 R557L possibly damaging Het
Pdyn C A 2: 129,689,809 M20I probably benign Het
Pelp1 G A 11: 70,393,715 probably null Het
Pkd2 T C 5: 104,478,924 V324A probably damaging Het
Pkdrej A G 15: 85,819,167 I856T probably benign Het
Polr1a T C 6: 71,936,552 probably null Het
Pot1a A T 6: 25,753,324 D404E probably benign Het
Ppp2r2a A T 14: 67,016,429 I430N possibly damaging Het
Prob1 C T 18: 35,654,226 R325Q possibly damaging Het
Prrc2a T C 17: 35,157,908 D742G probably damaging Het
Psmc1 C T 12: 100,114,843 P54S probably benign Het
Rab22a A G 2: 173,688,211 T61A probably damaging Het
Rims1 T A 1: 22,288,530 K184N probably damaging Het
Rnf213 G A 11: 119,431,685 R1376H probably damaging Het
Ryr2 T C 13: 11,668,962 E3072G probably damaging Het
Serpina1b T C 12: 103,732,161 K143R probably benign Het
Slc22a15 T G 3: 101,880,189 probably null Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slc25a48 A C 13: 56,448,998 T31P probably damaging Het
Slc9a3 C T 13: 74,166,056 probably null Het
Slx4 T C 16: 3,987,166 *105W probably null Het
Smc6 A G 12: 11,299,398 N794S probably benign Het
Spata18 G A 5: 73,676,964 R387Q probably damaging Het
Sphkap C A 1: 83,267,441 E1486* probably null Het
Srsf6 C T 2: 162,934,483 probably benign Het
St8sia1 C T 6: 142,963,672 A33T probably damaging Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Tmem144 G T 3: 79,825,304 S222R probably damaging Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Top1 A T 2: 160,670,122 K27N unknown Het
Tox2 A G 2: 163,225,556 H30R probably benign Het
Tra2b T C 16: 22,247,243 probably benign Het
Trio A T 15: 27,833,056 V1165E probably damaging Het
Troap T A 15: 99,077,388 S145R probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ttc6 C T 12: 57,616,323 P302S probably benign Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ugt2b35 G T 5: 87,001,282 V131F probably damaging Het
Vmn1r167 G A 7: 23,505,027 T188I probably benign Het
Vmn1r46 G T 6: 89,976,734 M188I probably benign Het
Vmn2r115 T A 17: 23,359,414 N620K probably damaging Het
Vmn2r66 A G 7: 84,995,136 S689P probably damaging Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Zbtb16 T C 9: 48,659,778 S563G probably benign Het
Zfp319 T C 8: 95,328,571 T335A probably damaging Het
Zfp418 A G 7: 7,182,402 R455G possibly damaging Het
Other mutations in Atp8a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01289:Atp8a2 APN 14 59691461 missense probably benign 0.00
IGL01505:Atp8a2 APN 14 60028063 missense probably benign 0.00
IGL01614:Atp8a2 APN 14 60044988 missense probably damaging 0.99
IGL01621:Atp8a2 APN 14 60015868 splice site probably benign
IGL01634:Atp8a2 APN 14 59998062 missense probably benign 0.01
IGL01672:Atp8a2 APN 14 59691533 missense probably benign 0.01
IGL01898:Atp8a2 APN 14 60023513 missense probably damaging 1.00
IGL01945:Atp8a2 APN 14 60026160 missense probably damaging 1.00
IGL02006:Atp8a2 APN 14 59857048 missense possibly damaging 0.90
IGL02089:Atp8a2 APN 14 60026920 splice site probably null
IGL02211:Atp8a2 APN 14 60027976 missense probably benign 0.00
IGL02283:Atp8a2 APN 14 60016799 missense possibly damaging 0.86
IGL02337:Atp8a2 APN 14 59998002 missense probably benign 0.32
IGL02571:Atp8a2 APN 14 60012458 splice site probably benign
IGL02795:Atp8a2 APN 14 60033742 missense probably damaging 0.96
IGL02874:Atp8a2 APN 14 59802252 missense probably damaging 1.00
IGL02999:Atp8a2 APN 14 59925122 nonsense probably null
IGL03307:Atp8a2 APN 14 60015872 critical splice donor site probably null
IGL03345:Atp8a2 APN 14 59774011 missense probably benign
PIT4431001:Atp8a2 UTSW 14 59654626 missense probably benign
R0334:Atp8a2 UTSW 14 59691512 missense probably damaging 1.00
R0368:Atp8a2 UTSW 14 59860212 missense probably damaging 1.00
R0420:Atp8a2 UTSW 14 59773744 missense probably damaging 1.00
R0684:Atp8a2 UTSW 14 60023144 missense probably benign 0.00
R0755:Atp8a2 UTSW 14 60009881 missense possibly damaging 0.96
R0853:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0908:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R0991:Atp8a2 UTSW 14 59793929 missense probably benign 0.33
R1025:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1190:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1387:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1426:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1442:Atp8a2 UTSW 14 59860323 splice site probably benign
R1472:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1538:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1573:Atp8a2 UTSW 14 59860206 missense probably benign 0.00
R1620:Atp8a2 UTSW 14 59791183 missense probably benign
R1661:Atp8a2 UTSW 14 59860186 missense possibly damaging 0.80
R1673:Atp8a2 UTSW 14 59791240 missense probably benign 0.00
R1749:Atp8a2 UTSW 14 59860174 nonsense probably null
R1796:Atp8a2 UTSW 14 60020758 critical splice donor site probably null
R1815:Atp8a2 UTSW 14 60086624 missense probably damaging 1.00
R1836:Atp8a2 UTSW 14 60006366 missense possibly damaging 0.49
R1935:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R1936:Atp8a2 UTSW 14 59860270 missense probably benign 0.01
R2416:Atp8a2 UTSW 14 59925008 missense probably damaging 1.00
R2760:Atp8a2 UTSW 14 59860192 missense probably benign 0.43
R3029:Atp8a2 UTSW 14 59691465 frame shift probably null
R3621:Atp8a2 UTSW 14 60026138 splice site probably null
R3768:Atp8a2 UTSW 14 60044336 missense probably benign 0.19
R3784:Atp8a2 UTSW 14 59773966 missense probably damaging 1.00
R3896:Atp8a2 UTSW 14 60026140 critical splice donor site probably null
R4009:Atp8a2 UTSW 14 60027985 missense possibly damaging 0.54
R4591:Atp8a2 UTSW 14 59654629 missense probably benign 0.03
R4866:Atp8a2 UTSW 14 59691467 missense probably damaging 1.00
R4879:Atp8a2 UTSW 14 60008469 nonsense probably null
R5059:Atp8a2 UTSW 14 59691537 missense probably benign 0.00
R5529:Atp8a2 UTSW 14 59793865 critical splice donor site probably null
R5788:Atp8a2 UTSW 14 60020793 missense probably damaging 0.96
R6126:Atp8a2 UTSW 14 60044326 missense probably benign
R6295:Atp8a2 UTSW 14 60012399 nonsense probably null
R6393:Atp8a2 UTSW 14 59773755 nonsense probably null
R6454:Atp8a2 UTSW 14 60008499 splice site probably null
R6651:Atp8a2 UTSW 14 59774021 missense probably benign 0.00
R6763:Atp8a2 UTSW 14 60008408 missense probably benign 0.12
R6767:Atp8a2 UTSW 14 60046722 missense probably damaging 1.00
R6912:Atp8a2 UTSW 14 60012410 missense probably benign 0.33
R7032:Atp8a2 UTSW 14 60017840 intron probably null
R7243:Atp8a2 UTSW 14 59647842 missense probably benign
Z1088:Atp8a2 UTSW 14 60027970 missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCCAAGGTAGGCAGAGTC -3'
(R):5'- CAAAGCTTCTTTGCACATGAAC -3'

Sequencing Primer
(F):5'- CCAAGGTAGGCAGAGTCCTTGG -3'
(R):5'- GAACATAAAATATAAGCGCTGGGTTC -3'
Posted On2014-07-14