Incidental Mutation 'R0126:Trrap'
ID21362
Institutional Source Beutler Lab
Gene Symbol Trrap
Ensembl Gene ENSMUSG00000045482
Gene Nametransformation/transcription domain-associated protein
Synonymstransactivation/transformation-domain associated protein
MMRRC Submission 038411-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0126 (G1)
Quality Score225
Status Validated (trace)
Chromosome5
Chromosomal Location144767732-144859778 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 144805750 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 1393 (K1393*)
Ref Sequence ENSEMBL: ENSMUSP00000148419 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038980] [ENSMUST00000094120] [ENSMUST00000100467] [ENSMUST00000213013]
Predicted Effect probably null
Transcript: ENSMUST00000038980
AA Change: K1392*
SMART Domains Protein: ENSMUSP00000042544
Gene: ENSMUSG00000045482
AA Change: K1392*

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3363 3376 N/A INTRINSIC
low complexity region 3407 3418 N/A INTRINSIC
PI3Kc 3509 3798 5.11e-8 SMART
FATC 3797 3829 1.89e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000094120
AA Change: K1392*
SMART Domains Protein: ENSMUSP00000091668
Gene: ENSMUSG00000045482
AA Change: K1392*

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1682 2e-6 SMART
low complexity region 1850 1861 N/A INTRINSIC
low complexity region 1884 1899 N/A INTRINSIC
low complexity region 2307 2321 N/A INTRINSIC
Pfam:FAT 2848 3203 1.1e-68 PFAM
low complexity region 3392 3405 N/A INTRINSIC
low complexity region 3436 3447 N/A INTRINSIC
PI3Kc 3538 3827 5.11e-8 SMART
FATC 3826 3858 1.89e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000100467
AA Change: K1392*
SMART Domains Protein: ENSMUSP00000098035
Gene: ENSMUSG00000045482
AA Change: K1392*

DomainStartEndE-ValueType
low complexity region 482 527 N/A INTRINSIC
low complexity region 529 540 N/A INTRINSIC
Blast:PI3Kc 765 864 1e-13 BLAST
SCOP:d1gw5a_ 1184 1664 2e-6 SMART
low complexity region 1832 1843 N/A INTRINSIC
low complexity region 1866 1881 N/A INTRINSIC
low complexity region 2289 2303 N/A INTRINSIC
Pfam:FAT 2830 3174 4.7e-69 PFAM
low complexity region 3381 3394 N/A INTRINSIC
low complexity region 3425 3436 N/A INTRINSIC
PI3Kc 3527 3816 5.11e-8 SMART
FATC 3815 3847 1.89e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132347
Predicted Effect probably null
Transcript: ENSMUST00000132925
AA Change: K1106*
SMART Domains Protein: ENSMUSP00000122021
Gene: ENSMUSG00000045482
AA Change: K1106*

DomainStartEndE-ValueType
low complexity region 197 242 N/A INTRINSIC
low complexity region 244 255 N/A INTRINSIC
SCOP:d1gw5a_ 474 1003 9e-7 SMART
Blast:PI3Kc 480 579 1e-13 BLAST
low complexity region 1083 1092 N/A INTRINSIC
low complexity region 1572 1583 N/A INTRINSIC
low complexity region 1606 1621 N/A INTRINSIC
low complexity region 2029 2043 N/A INTRINSIC
Pfam:FAT 2570 2914 1.5e-69 PFAM
low complexity region 3121 3134 N/A INTRINSIC
low complexity region 3165 3176 N/A INTRINSIC
PI3Kc 3267 3556 5.11e-8 SMART
FATC 3555 3587 1.89e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000213013
AA Change: K1393*
Meta Mutation Damage Score 0.618 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.2%
  • 20x: 81.8%
Validation Efficiency 98% (102/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large multidomain protein of the phosphoinositide 3-kinase-related kinases (PIKK) family. The encoded protein is a common component of many histone acetyltransferase (HAT) complexes and plays a role in transcription and DNA repair by recruiting HAT complexes to chromatin. Deregulation of this gene may play a role in several types of cancer including glioblastoma multiforme. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous embryos die prior to E3.5 and exhibit embryonic and extraembryonic tissue disorganization. Mitotic abnormalities were also noted in homozygous cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,443,730 L1730P possibly damaging Het
Adam9 T C 8: 24,970,737 N577S probably damaging Het
Add1 T C 5: 34,613,579 Y316H probably benign Het
Agpat3 T C 10: 78,278,056 D266G probably null Het
Aldh3a2 C A 11: 61,224,558 Q524H probably benign Het
Alox12b A C 11: 69,167,471 S550R probably benign Het
Ano4 T A 10: 88,952,292 I753F possibly damaging Het
AW011738 T A 4: 156,203,647 probably benign Het
B4galt3 C T 1: 171,276,165 T103M probably damaging Het
Cabs1 C T 5: 87,980,195 T235I probably damaging Het
Casc4 T C 2: 121,906,084 probably benign Het
Casq2 A G 3: 102,133,399 H272R probably damaging Het
Ccdc180 T C 4: 45,912,866 probably null Het
Cdh12 A T 15: 21,583,945 M624L probably benign Het
Cdh5 A C 8: 104,140,682 probably null Het
Col7a1 A G 9: 108,969,583 probably benign Het
Cpne2 A T 8: 94,554,933 I199F probably damaging Het
Crebbp A T 16: 4,084,063 F2399L possibly damaging Het
Defb36 T C 2: 152,612,579 C53R probably damaging Het
Degs1 T C 1: 182,279,692 M1V probably null Het
Disp2 T A 2: 118,790,338 F517Y probably damaging Het
Dnah5 A G 15: 28,246,319 D601G probably benign Het
Dnpep G A 1: 75,312,538 Q310* probably null Het
Dsg1a A G 18: 20,340,878 T1003A probably benign Het
Fbrsl1 C G 5: 110,396,040 probably benign Het
Foxh1 A T 15: 76,669,254 L116H probably damaging Het
Gigyf2 G A 1: 87,411,875 probably benign Het
Gp1ba A T 11: 70,641,033 probably benign Het
Gucy1b1 A G 3: 82,037,911 probably benign Het
Gucy2g T G 19: 55,241,166 D24A probably benign Het
Hirip3 A G 7: 126,863,442 K190R probably damaging Het
Hmmr T C 11: 40,705,954 N717D probably damaging Het
Il12b A T 11: 44,410,218 Y187F probably damaging Het
Iqgap1 A G 7: 80,738,322 I859T probably benign Het
Jmjd1c T C 10: 67,219,326 L175P probably damaging Het
Klc2 T C 19: 5,112,746 M242V possibly damaging Het
Klf3 T C 5: 64,822,103 M96T probably benign Het
Lrrc66 G T 5: 73,607,088 H871N probably benign Het
Ltn1 A T 16: 87,425,640 D168E probably benign Het
Mak T C 13: 41,032,596 D532G probably damaging Het
March6 A G 15: 31,462,005 M859T probably benign Het
Mlxipl C A 5: 135,132,323 N365K probably damaging Het
Mplkip T C 13: 17,695,752 S90P possibly damaging Het
Myo5c A T 9: 75,269,525 H584L probably benign Het
Myt1l A G 12: 29,851,720 T228A possibly damaging Het
Nxpe3 A T 16: 55,866,229 Y139N possibly damaging Het
Olfr1090 T A 2: 86,754,637 I34L probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr568 A G 7: 102,877,140 T7A probably benign Het
Pak6 C T 2: 118,690,332 S268F possibly damaging Het
Parp10 G A 15: 76,243,066 A57V probably damaging Het
Pik3r3 T A 4: 116,256,268 D69E probably damaging Het
Polr2a T G 11: 69,747,425 K105T probably damaging Het
Prdm16 A T 4: 154,328,838 probably benign Het
Prepl G A 17: 85,083,242 T96I probably benign Het
Ret C T 6: 118,165,995 probably benign Het
Rgl3 A T 9: 21,975,812 D541E probably benign Het
Rpa1 A C 11: 75,318,529 Y143D probably benign Het
Rps16 T A 7: 28,351,083 L47Q probably damaging Het
Sbno2 A T 10: 80,068,853 probably null Het
Scube1 A T 15: 83,621,063 N385K probably damaging Het
Shank2 A G 7: 144,031,355 E31G probably damaging Het
Slc38a9 G T 13: 112,729,257 C496F possibly damaging Het
Snap47 A G 11: 59,437,987 V163A probably damaging Het
Sntg2 T C 12: 30,201,261 probably benign Het
Sp7 C A 15: 102,358,460 V322F probably damaging Het
Spic T C 10: 88,676,062 K111E probably damaging Het
Sqor T C 2: 122,798,027 probably benign Het
St6galnac1 T A 11: 116,766,584 M385L probably benign Het
Synpo2 A T 3: 123,079,862 S1211T possibly damaging Het
Sytl2 T A 7: 90,396,589 V638E probably damaging Het
Taar1 T A 10: 23,920,547 S48T probably benign Het
Tbx18 T A 9: 87,729,653 D108V possibly damaging Het
Tdh C T 14: 63,497,593 probably benign Het
Tldc1 T C 8: 119,762,350 D398G possibly damaging Het
Tlr9 T A 9: 106,225,682 L724Q probably benign Het
Tmem270 T A 5: 134,902,788 Y100F probably benign Het
Trim65 G C 11: 116,124,604 probably benign Het
Ttc13 A G 8: 124,683,291 V523A probably damaging Het
Utrn T A 10: 12,711,475 D939V probably benign Het
Vmn1r46 G T 6: 89,976,953 M261I probably benign Het
Vwa5a A G 9: 38,737,807 probably null Het
Zfp108 A T 7: 24,260,724 T247S probably benign Het
Zfp366 A T 13: 99,228,621 I97F probably benign Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Trrap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Trrap APN 5 144779974 splice site probably benign
IGL00470:Trrap APN 5 144818038 missense probably damaging 1.00
IGL00490:Trrap APN 5 144825225 missense probably benign 0.40
IGL01072:Trrap APN 5 144784255 splice site probably benign
IGL01087:Trrap APN 5 144846539 missense probably damaging 0.99
IGL01300:Trrap APN 5 144804818 missense probably damaging 1.00
IGL01350:Trrap APN 5 144830969 missense possibly damaging 0.92
IGL01410:Trrap APN 5 144831021 missense probably benign 0.00
IGL01571:Trrap APN 5 144833287 splice site probably benign
IGL01748:Trrap APN 5 144833340 missense probably damaging 1.00
IGL01839:Trrap APN 5 144821875 missense probably damaging 1.00
IGL01976:Trrap APN 5 144856989 missense probably benign 0.00
IGL02075:Trrap APN 5 144828494 missense probably benign 0.00
IGL02127:Trrap APN 5 144816433 missense probably benign 0.22
IGL02131:Trrap APN 5 144840436 missense probably damaging 1.00
IGL02287:Trrap APN 5 144832538 missense probably damaging 1.00
IGL02301:Trrap APN 5 144777917 missense probably benign 0.05
IGL02336:Trrap APN 5 144798390 missense probably benign 0.39
IGL02526:Trrap APN 5 144824550 missense probably benign 0.00
IGL02873:Trrap APN 5 144841079 splice site probably benign
IGL02953:Trrap APN 5 144815964 missense probably damaging 0.99
IGL03404:Trrap APN 5 144833186 missense probably benign 0.00
Card-tower UTSW 5 144804766 missense probably damaging 1.00
PIT4243001:Trrap UTSW 5 144796971 missense probably benign 0.00
PIT4466001:Trrap UTSW 5 144828600 missense probably benign 0.02
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0062:Trrap UTSW 5 144782193 splice site probably benign
R0112:Trrap UTSW 5 144822761 nonsense probably null
R0257:Trrap UTSW 5 144804235 missense probably benign 0.31
R0325:Trrap UTSW 5 144816395 missense probably benign 0.05
R0376:Trrap UTSW 5 144816339 missense probably benign 0.03
R0396:Trrap UTSW 5 144814556 missense probably damaging 0.99
R0448:Trrap UTSW 5 144839567 missense possibly damaging 0.66
R0454:Trrap UTSW 5 144846477 missense probably damaging 1.00
R0711:Trrap UTSW 5 144853499 missense probably damaging 1.00
R0827:Trrap UTSW 5 144814830 missense probably benign 0.00
R1005:Trrap UTSW 5 144805727 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1147:Trrap UTSW 5 144804766 missense probably damaging 1.00
R1179:Trrap UTSW 5 144777939 missense possibly damaging 0.94
R1218:Trrap UTSW 5 144816409 missense probably damaging 1.00
R1264:Trrap UTSW 5 144789599 splice site probably benign
R1374:Trrap UTSW 5 144846618 missense probably damaging 1.00
R1401:Trrap UTSW 5 144857422 missense possibly damaging 0.93
R1480:Trrap UTSW 5 144818313 missense probably benign
R1538:Trrap UTSW 5 144837202 missense possibly damaging 0.65
R1751:Trrap UTSW 5 144814575 critical splice donor site probably null
R1779:Trrap UTSW 5 144828590 missense probably benign 0.01
R1782:Trrap UTSW 5 144822703 missense possibly damaging 0.93
R1792:Trrap UTSW 5 144853586 missense possibly damaging 0.87
R1859:Trrap UTSW 5 144830951 missense probably benign 0.04
R1861:Trrap UTSW 5 144815917 splice site probably null
R1902:Trrap UTSW 5 144816053 missense probably damaging 1.00
R1903:Trrap UTSW 5 144816053 missense probably damaging 1.00
R2021:Trrap UTSW 5 144853488 missense possibly damaging 0.94
R2026:Trrap UTSW 5 144803044 missense possibly damaging 0.86
R2036:Trrap UTSW 5 144828562 missense probably benign 0.08
R2099:Trrap UTSW 5 144782239 missense possibly damaging 0.46
R2108:Trrap UTSW 5 144825874 missense probably benign 0.01
R2113:Trrap UTSW 5 144844211 missense probably damaging 1.00
R2174:Trrap UTSW 5 144821855 missense probably benign 0.40
R2442:Trrap UTSW 5 144817966 missense probably damaging 1.00
R2568:Trrap UTSW 5 144843369 critical splice donor site probably null
R3442:Trrap UTSW 5 144792252 missense probably benign 0.03
R3853:Trrap UTSW 5 144792165 missense probably damaging 1.00
R4401:Trrap UTSW 5 144843318 missense possibly damaging 0.60
R4493:Trrap UTSW 5 144831048 missense probably benign 0.21
R4524:Trrap UTSW 5 144825321 missense probably benign 0.38
R4569:Trrap UTSW 5 144792118 missense probably benign 0.13
R4672:Trrap UTSW 5 144785480 missense probably damaging 0.97
R4732:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4733:Trrap UTSW 5 144816570 missense probably damaging 1.00
R4791:Trrap UTSW 5 144803277 missense probably damaging 1.00
R4795:Trrap UTSW 5 144832488 missense probably benign 0.06
R4827:Trrap UTSW 5 144800948 missense probably benign 0.02
R4839:Trrap UTSW 5 144845592 missense probably damaging 1.00
R4915:Trrap UTSW 5 144805735 missense probably damaging 0.99
R4951:Trrap UTSW 5 144805720 missense possibly damaging 0.65
R4959:Trrap UTSW 5 144856960 missense probably damaging 1.00
R5049:Trrap UTSW 5 144826717 missense probably damaging 1.00
R5074:Trrap UTSW 5 144851179 missense probably damaging 1.00
R5236:Trrap UTSW 5 144817786 missense probably benign 0.07
R5281:Trrap UTSW 5 144813503 missense probably benign 0.13
R5322:Trrap UTSW 5 144844224 missense probably damaging 1.00
R5457:Trrap UTSW 5 144849977 missense probably damaging 1.00
R5590:Trrap UTSW 5 144782265 missense probably benign 0.05
R5799:Trrap UTSW 5 144830945 missense probably benign
R5885:Trrap UTSW 5 144794793 missense probably damaging 1.00
R5905:Trrap UTSW 5 144849920 missense possibly damaging 0.95
R5908:Trrap UTSW 5 144786708 missense probably damaging 0.96
R5956:Trrap UTSW 5 144807391 splice site silent
R5992:Trrap UTSW 5 144810184 missense probably benign 0.00
R6017:Trrap UTSW 5 144844241 missense probably damaging 1.00
R6029:Trrap UTSW 5 144817679 missense possibly damaging 0.94
R6029:Trrap UTSW 5 144825914 missense possibly damaging 0.75
R6117:Trrap UTSW 5 144802961 missense possibly damaging 0.78
R6166:Trrap UTSW 5 144781981 missense possibly damaging 0.66
R6234:Trrap UTSW 5 144839713 intron probably null
R6288:Trrap UTSW 5 144811992 missense probably damaging 1.00
R6290:Trrap UTSW 5 144805018 missense probably damaging 1.00
R6316:Trrap UTSW 5 144813526 missense probably benign 0.02
R6398:Trrap UTSW 5 144790870 missense possibly damaging 0.83
R6413:Trrap UTSW 5 144784046 missense possibly damaging 0.83
R6499:Trrap UTSW 5 144857002 missense probably damaging 1.00
R6529:Trrap UTSW 5 144834204 missense probably benign 0.06
R6574:Trrap UTSW 5 144815550 critical splice donor site probably null
R6631:Trrap UTSW 5 144771650 missense possibly damaging 0.94
R6727:Trrap UTSW 5 144856950 missense probably damaging 1.00
R6776:Trrap UTSW 5 144851256 nonsense probably null
R6914:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6942:Trrap UTSW 5 144784043 missense possibly damaging 0.83
R6945:Trrap UTSW 5 144790855 missense possibly damaging 0.66
R7023:Trrap UTSW 5 144792154 missense possibly damaging 0.64
R7107:Trrap UTSW 5 144797135 missense probably benign 0.05
R7139:Trrap UTSW 5 144803178 missense possibly damaging 0.65
R7148:Trrap UTSW 5 144821803 missense possibly damaging 0.77
X0060:Trrap UTSW 5 144843361 missense probably damaging 0.96
Z1088:Trrap UTSW 5 144834197 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGCACATAGAGCCGTTCCCATCAG -3'
(R):5'- TGTTTCCCGACTCAGTGTGACGAG -3'

Sequencing Primer
(F):5'- tgtgccaccaagcccag -3'
(R):5'- CTCAGTGTGACGAGGGCAG -3'
Posted On2013-04-11