Incidental Mutation 'R0126:Iqgap1'
ID21367
Institutional Source Beutler Lab
Gene Symbol Iqgap1
Ensembl Gene ENSMUSG00000030536
Gene NameIQ motif containing GTPase activating protein 1
SynonymsD7Ertd237e, D7Ertd257e
MMRRC Submission 038411-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0126 (G1)
Quality Score200
Status Validated
Chromosome7
Chromosomal Location80711583-80825974 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 80738322 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 859 (I859T)
Ref Sequence ENSEMBL: ENSMUSP00000128278 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167377]
Predicted Effect probably benign
Transcript: ENSMUST00000167377
AA Change: I859T

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000128278
Gene: ENSMUSG00000030536
AA Change: I859T

DomainStartEndE-ValueType
CH 46 155 2.02e-20 SMART
internal_repeat_1 203 278 3.71e-8 PROSPERO
low complexity region 324 335 N/A INTRINSIC
low complexity region 390 399 N/A INTRINSIC
coiled coil region 488 515 N/A INTRINSIC
internal_repeat_1 608 684 3.71e-8 PROSPERO
IQ 744 766 3.85e-3 SMART
IQ 774 796 1.12e-4 SMART
IQ 804 826 1.32e-1 SMART
IQ 834 856 1.15e1 SMART
coiled coil region 886 914 N/A INTRINSIC
RasGAP 992 1345 7.46e-89 SMART
Pfam:RasGAP_C 1452 1580 4.5e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205383
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.2%
  • 20x: 81.8%
Validation Efficiency 98% (102/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the IQGAP family. The protein contains four IQ domains, one calponin homology domain, one Ras-GAP domain and one WW domain. It interacts with components of the cytoskeleton, with cell adhesion molecules, and with several signaling molecules to regulate cell morphology and motility. Expression of the protein is upregulated by gene amplification in two gastric cancer cell lines. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null allele exhibit a late-onset gastric hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,443,730 L1730P possibly damaging Het
Adam9 T C 8: 24,970,737 N577S probably damaging Het
Add1 T C 5: 34,613,579 Y316H probably benign Het
Agpat3 T C 10: 78,278,056 D266G probably null Het
Aldh3a2 C A 11: 61,224,558 Q524H probably benign Het
Alox12b A C 11: 69,167,471 S550R probably benign Het
Ano4 T A 10: 88,952,292 I753F possibly damaging Het
AW011738 T A 4: 156,203,647 probably benign Het
B4galt3 C T 1: 171,276,165 T103M probably damaging Het
Cabs1 C T 5: 87,980,195 T235I probably damaging Het
Casc4 T C 2: 121,906,084 probably benign Het
Casq2 A G 3: 102,133,399 H272R probably damaging Het
Ccdc180 T C 4: 45,912,866 probably null Het
Cdh12 A T 15: 21,583,945 M624L probably benign Het
Cdh5 A C 8: 104,140,682 probably null Het
Col7a1 A G 9: 108,969,583 probably benign Het
Cpne2 A T 8: 94,554,933 I199F probably damaging Het
Crebbp A T 16: 4,084,063 F2399L possibly damaging Het
Defb36 T C 2: 152,612,579 C53R probably damaging Het
Degs1 T C 1: 182,279,692 M1V probably null Het
Disp2 T A 2: 118,790,338 F517Y probably damaging Het
Dnah5 A G 15: 28,246,319 D601G probably benign Het
Dnpep G A 1: 75,312,538 Q310* probably null Het
Dsg1a A G 18: 20,340,878 T1003A probably benign Het
Fbrsl1 C G 5: 110,396,040 probably benign Het
Foxh1 A T 15: 76,669,254 L116H probably damaging Het
Gigyf2 G A 1: 87,411,875 probably benign Het
Gp1ba A T 11: 70,641,033 probably benign Het
Gucy1b1 A G 3: 82,037,911 probably benign Het
Gucy2g T G 19: 55,241,166 D24A probably benign Het
Hirip3 A G 7: 126,863,442 K190R probably damaging Het
Hmmr T C 11: 40,705,954 N717D probably damaging Het
Il12b A T 11: 44,410,218 Y187F probably damaging Het
Jmjd1c T C 10: 67,219,326 L175P probably damaging Het
Klc2 T C 19: 5,112,746 M242V possibly damaging Het
Klf3 T C 5: 64,822,103 M96T probably benign Het
Lrrc66 G T 5: 73,607,088 H871N probably benign Het
Ltn1 A T 16: 87,425,640 D168E probably benign Het
Mak T C 13: 41,032,596 D532G probably damaging Het
March6 A G 15: 31,462,005 M859T probably benign Het
Mlxipl C A 5: 135,132,323 N365K probably damaging Het
Mplkip T C 13: 17,695,752 S90P possibly damaging Het
Myo5c A T 9: 75,269,525 H584L probably benign Het
Myt1l A G 12: 29,851,720 T228A possibly damaging Het
Nxpe3 A T 16: 55,866,229 Y139N possibly damaging Het
Olfr1090 T A 2: 86,754,637 I34L probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr568 A G 7: 102,877,140 T7A probably benign Het
Pak6 C T 2: 118,690,332 S268F possibly damaging Het
Parp10 G A 15: 76,243,066 A57V probably damaging Het
Pik3r3 T A 4: 116,256,268 D69E probably damaging Het
Polr2a T G 11: 69,747,425 K105T probably damaging Het
Prdm16 A T 4: 154,328,838 probably benign Het
Prepl G A 17: 85,083,242 T96I probably benign Het
Ret C T 6: 118,165,995 probably benign Het
Rgl3 A T 9: 21,975,812 D541E probably benign Het
Rpa1 A C 11: 75,318,529 Y143D probably benign Het
Rps16 T A 7: 28,351,083 L47Q probably damaging Het
Sbno2 A T 10: 80,068,853 probably null Het
Scube1 A T 15: 83,621,063 N385K probably damaging Het
Shank2 A G 7: 144,031,355 E31G probably damaging Het
Slc38a9 G T 13: 112,729,257 C496F possibly damaging Het
Snap47 A G 11: 59,437,987 V163A probably damaging Het
Sntg2 T C 12: 30,201,261 probably benign Het
Sp7 C A 15: 102,358,460 V322F probably damaging Het
Spic T C 10: 88,676,062 K111E probably damaging Het
Sqor T C 2: 122,798,027 probably benign Het
St6galnac1 T A 11: 116,766,584 M385L probably benign Het
Synpo2 A T 3: 123,079,862 S1211T possibly damaging Het
Sytl2 T A 7: 90,396,589 V638E probably damaging Het
Taar1 T A 10: 23,920,547 S48T probably benign Het
Tbx18 T A 9: 87,729,653 D108V possibly damaging Het
Tdh C T 14: 63,497,593 probably benign Het
Tldc1 T C 8: 119,762,350 D398G possibly damaging Het
Tlr9 T A 9: 106,225,682 L724Q probably benign Het
Tmem270 T A 5: 134,902,788 Y100F probably benign Het
Trim65 G C 11: 116,124,604 probably benign Het
Trrap A T 5: 144,805,750 K1393* probably null Het
Ttc13 A G 8: 124,683,291 V523A probably damaging Het
Utrn T A 10: 12,711,475 D939V probably benign Het
Vmn1r46 G T 6: 89,976,953 M261I probably benign Het
Vwa5a A G 9: 38,737,807 probably null Het
Zfp108 A T 7: 24,260,724 T247S probably benign Het
Zfp366 A T 13: 99,228,621 I97F probably benign Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Iqgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Iqgap1 APN 7 80759844 missense probably benign 0.00
IGL00984:Iqgap1 APN 7 80726798 missense probably damaging 1.00
IGL01570:Iqgap1 APN 7 80723061 missense possibly damaging 0.76
IGL01738:Iqgap1 APN 7 80723900 missense possibly damaging 0.80
IGL02141:Iqgap1 APN 7 80738121 missense probably damaging 1.00
IGL02336:Iqgap1 APN 7 80752293 missense probably benign 0.39
IGL02416:Iqgap1 APN 7 80726038 missense probably damaging 1.00
IGL02597:Iqgap1 APN 7 80723885 missense probably damaging 1.00
IGL02662:Iqgap1 APN 7 80743079 missense probably benign
IGL03157:Iqgap1 APN 7 80751888 missense probably benign 0.34
IGL03189:Iqgap1 APN 7 80713842 missense probably benign 0.12
IGL03216:Iqgap1 APN 7 80743088 missense probably benign 0.33
R0024:Iqgap1 UTSW 7 80751939 missense probably benign
R0144:Iqgap1 UTSW 7 80751920 missense probably damaging 1.00
R0325:Iqgap1 UTSW 7 80751930 missense probably benign 0.01
R0376:Iqgap1 UTSW 7 80723879 missense probably benign 0.01
R0650:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0652:Iqgap1 UTSW 7 80736395 missense probably damaging 1.00
R0741:Iqgap1 UTSW 7 80720987 missense probably benign 0.03
R0751:Iqgap1 UTSW 7 80725573 unclassified probably benign
R1067:Iqgap1 UTSW 7 80723828 missense probably benign 0.01
R1389:Iqgap1 UTSW 7 80759756 critical splice donor site probably null
R1473:Iqgap1 UTSW 7 80734011 missense probably benign 0.00
R1613:Iqgap1 UTSW 7 80768457 missense probably damaging 1.00
R1842:Iqgap1 UTSW 7 80760883 missense probably damaging 1.00
R1909:Iqgap1 UTSW 7 80743828 missense probably benign
R2062:Iqgap1 UTSW 7 80723979 nonsense probably null
R2149:Iqgap1 UTSW 7 80762560 missense probably damaging 1.00
R2153:Iqgap1 UTSW 7 80751953 missense probably benign 0.00
R2153:Iqgap1 UTSW 7 80759903 missense possibly damaging 0.55
R3160:Iqgap1 UTSW 7 80752338 missense probably benign
R3162:Iqgap1 UTSW 7 80752338 missense probably benign
R3605:Iqgap1 UTSW 7 80723789 missense probably benign 0.02
R3709:Iqgap1 UTSW 7 80717087 missense possibly damaging 0.87
R3935:Iqgap1 UTSW 7 80743837 missense possibly damaging 0.54
R3979:Iqgap1 UTSW 7 80759934 missense probably damaging 0.98
R4545:Iqgap1 UTSW 7 80762567 critical splice acceptor site probably null
R4787:Iqgap1 UTSW 7 80735513 missense probably damaging 1.00
R4925:Iqgap1 UTSW 7 80765317 missense probably damaging 1.00
R4953:Iqgap1 UTSW 7 80723776 splice site probably null
R5037:Iqgap1 UTSW 7 80734100 missense probably damaging 1.00
R5158:Iqgap1 UTSW 7 80743068 missense probably benign 0.02
R5183:Iqgap1 UTSW 7 80723065 missense probably damaging 1.00
R5262:Iqgap1 UTSW 7 80726742 missense probably benign 0.00
R5271:Iqgap1 UTSW 7 80734148 missense probably damaging 1.00
R5289:Iqgap1 UTSW 7 80738724 missense possibly damaging 0.88
R5359:Iqgap1 UTSW 7 80766959 missense probably benign 0.00
R5423:Iqgap1 UTSW 7 80799862 missense probably damaging 1.00
R5843:Iqgap1 UTSW 7 80726080 missense probably benign 0.03
R5849:Iqgap1 UTSW 7 80803158 missense probably benign
R6164:Iqgap1 UTSW 7 80809106 missense unknown
R6315:Iqgap1 UTSW 7 80799890 missense possibly damaging 0.65
R6335:Iqgap1 UTSW 7 80728024 missense probably damaging 1.00
R6488:Iqgap1 UTSW 7 80730326 missense probably benign 0.00
R6723:Iqgap1 UTSW 7 80723822 missense probably benign 0.01
R6800:Iqgap1 UTSW 7 80728981 missense possibly damaging 0.56
R6815:Iqgap1 UTSW 7 80766884 critical splice donor site probably null
X0064:Iqgap1 UTSW 7 80720931 nonsense probably null
X0067:Iqgap1 UTSW 7 80766903 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGACTCCACACTCCCTGTTAGAC -3'
(R):5'- TAACCCGACTACGGACTGCACTTG -3'

Sequencing Primer
(F):5'- CTGTTAGACAAGGCTGGACTC -3'
(R):5'- GACGATTGTCTGAGCACGTT -3'
Posted On2013-04-11