Incidental Mutation 'R1938:Espl1'
ID213751
Institutional Source Beutler Lab
Gene Symbol Espl1
Ensembl Gene ENSMUSG00000058290
Gene Nameextra spindle pole bodies 1, separase
SynonymsSSE, ESP1, PRCE, Cerp, PRCE, separase
MMRRC Submission 039956-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1938 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102296266-102324357 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102305042 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 601 (I601T)
Ref Sequence ENSEMBL: ENSMUSP00000155304 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064924] [ENSMUST00000229050]
Predicted Effect probably benign
Transcript: ENSMUST00000064924
AA Change: I601T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000064465
Gene: ENSMUSG00000058290
AA Change: I601T

DomainStartEndE-ValueType
low complexity region 236 245 N/A INTRINSIC
low complexity region 433 445 N/A INTRINSIC
low complexity region 785 794 N/A INTRINSIC
low complexity region 907 918 N/A INTRINSIC
low complexity region 1312 1317 N/A INTRINSIC
low complexity region 1565 1579 N/A INTRINSIC
low complexity region 1625 1636 N/A INTRINSIC
Pfam:Peptidase_C50 1716 2065 4.2e-93 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000229050
AA Change: I601T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230120
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 96.9%
  • 10x: 95.4%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Stable cohesion between sister chromatids before anaphase and their timely separation during anaphase are critical for chromosome inheritance. In vertebrates, sister chromatid cohesion is released in 2 steps via distinct mechanisms. The first step involves phosphorylation of STAG1 (MIM 604358) or STAG2 (MIM 300826) in the cohesin complex. The second step involves cleavage of the cohesin subunit SCC1 (RAD21; MIM 606462) by ESPL1, or separase, which initiates the final separation of sister chromatids (Sun et al., 2009 [PubMed 19345191]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation. Conditional null mice display abnormal mitosis during liver regeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 133 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T C 1: 93,152,008 *453W probably null Het
Abcc8 T C 7: 46,175,371 K134R possibly damaging Het
Adamts17 T C 7: 67,125,072 S980P probably damaging Het
Adap2 T A 11: 80,170,682 I221K probably damaging Het
Adgrv1 C T 13: 81,391,757 R5681Q probably damaging Het
Adipor1 T A 1: 134,423,103 L30Q probably benign Het
Agpat5 A G 8: 18,878,165 T249A probably benign Het
Agxt2 G T 15: 10,391,935 G329V probably damaging Het
Ankrd28 A G 14: 31,705,276 V801A possibly damaging Het
Ap1g2 A G 14: 55,099,772 V702A possibly damaging Het
Arid3a A G 10: 79,950,706 Q429R probably damaging Het
Arsb T A 13: 93,862,150 L322Q probably damaging Het
Ash1l A G 3: 88,984,422 T1203A probably damaging Het
Atad2 T A 15: 58,096,705 N1308Y possibly damaging Het
Atp10b A T 11: 43,230,418 R969S probably benign Het
Bmp10 T C 6: 87,433,720 I165T possibly damaging Het
Ccne1 A G 7: 38,106,277 probably null Het
Cenpe A G 3: 135,247,479 N1565D probably damaging Het
Chd1 A T 17: 15,762,486 E1404D probably benign Het
Chd7 G A 4: 8,847,200 E1648K probably damaging Het
Chodl T C 16: 78,941,426 I94T possibly damaging Het
Chsy3 T C 18: 59,409,512 F574S probably damaging Het
Clpb A T 7: 101,763,656 I317F probably damaging Het
Cnga3 T A 1: 37,261,873 V558D possibly damaging Het
Col9a1 C T 1: 24,222,473 P573S probably damaging Het
Crat A T 2: 30,413,061 D71E probably benign Het
Cspg4 A G 9: 56,887,101 T707A probably benign Het
Ctsr T A 13: 61,162,445 R132S probably benign Het
Ctu2 T C 8: 122,479,285 L255P probably damaging Het
Cyp2c69 T C 19: 39,849,366 Y424C probably damaging Het
Ddx27 A T 2: 167,034,109 K726N probably damaging Het
Dennd4a A G 9: 64,842,490 Q121R probably damaging Het
Dis3 A G 14: 99,097,590 F192S probably benign Het
Ect2l C T 10: 18,144,635 S487N probably benign Het
Eml1 T A 12: 108,521,396 F524L possibly damaging Het
Fbxo40 C A 16: 36,969,351 V466L probably damaging Het
Frmpd1 C T 4: 45,283,711 T844M probably damaging Het
Frs2 T A 10: 117,081,106 probably benign Het
Fuom G T 7: 140,099,608 T133K probably benign Het
Garnl3 T A 2: 33,005,200 H619L probably damaging Het
Gm4861 G T 3: 137,552,115 N36K unknown Het
Gm6588 C A 5: 112,449,801 C71* probably null Het
Gps2 G T 11: 69,915,369 M153I probably benign Het
Gtf2ird1 A G 5: 134,415,245 V52A probably damaging Het
Gtpbp8 A T 16: 44,745,422 D137E probably benign Het
Haus4 A G 14: 54,544,276 C213R probably damaging Het
Hdc T A 2: 126,606,397 H142L possibly damaging Het
Hephl1 T C 9: 15,053,987 D1069G possibly damaging Het
Herc6 T A 6: 57,625,941 V535D probably damaging Het
Hipk3 A T 2: 104,430,188 H1082Q possibly damaging Het
Hps5 A T 7: 46,773,267 V513D probably damaging Het
Ifna13 T A 4: 88,644,175 I71F probably damaging Het
Il1rl2 T C 1: 40,363,324 I426T probably damaging Het
Irf5 A T 6: 29,536,739 D483V probably benign Het
Jakmip3 A G 7: 139,020,138 R256G probably damaging Het
Jazf1 T C 6: 52,777,615 I159V probably damaging Het
Kmo A G 1: 175,651,588 D230G possibly damaging Het
Lrrc74b A G 16: 17,553,194 V213A probably benign Het
Ly6g5b T C 17: 35,114,728 D36G possibly damaging Het
Macc1 T G 12: 119,445,731 L78R probably damaging Het
Mettl4 A T 17: 94,747,857 D51E possibly damaging Het
Mfap1a G A 2: 121,502,354 L199F possibly damaging Het
Mmp17 G T 5: 129,602,126 R363L probably damaging Het
Mrc1 G A 2: 14,319,241 A1130T possibly damaging Het
Mrpl15 C T 1: 4,777,582 A165T probably damaging Het
Mrpl45 G A 11: 97,315,944 probably null Het
Ms4a3 C T 19: 11,635,840 A85T possibly damaging Het
Mttp A T 3: 138,125,121 D77E probably benign Het
Muc6 A G 7: 141,637,098 L2489P probably damaging Het
Myl3 G A 9: 110,766,734 E100K probably damaging Het
Nbea T A 3: 56,085,322 N288Y probably damaging Het
Ncoa7 A G 10: 30,698,170 V181A probably benign Het
Oat C T 7: 132,558,205 V429M probably benign Het
Olfr1152 G A 2: 87,868,461 V157I probably benign Het
Olfr1163 A T 2: 88,070,956 L142Q probably damaging Het
Olfr1269 T G 2: 90,119,083 I172L probably damaging Het
Olfr285 T A 15: 98,313,380 M57L probably damaging Het
Olfr319 A T 11: 58,702,623 *307C probably null Het
Olfr508 T C 7: 108,630,838 I282T probably benign Het
Olfr524 A G 7: 140,202,231 F180L probably benign Het
Olfr810 T A 10: 129,790,890 K233M probably damaging Het
Olfr922 A G 9: 38,815,850 T116A probably benign Het
Oraov1 A G 7: 144,916,468 S45G probably damaging Het
Otof A G 5: 30,376,369 S1464P probably benign Het
Otogl A T 10: 107,777,575 Y2010N probably damaging Het
Pgap3 C T 11: 98,400,214 probably null Het
Pgbd5 T A 8: 124,374,249 K332* probably null Het
Pgs1 C T 11: 118,005,727 P410L probably damaging Het
Pkhd1l1 G A 15: 44,500,038 S618N probably benign Het
Plcb1 A T 2: 135,386,302 D1073V probably damaging Het
Pola2 T A 19: 5,951,180 T309S probably benign Het
Polg2 T A 11: 106,778,961 H161L probably damaging Het
Postn T A 3: 54,377,612 probably null Het
Ppt1 G T 4: 122,845,991 C128F probably damaging Het
Ptpn12 G A 5: 20,993,263 P678S probably damaging Het
Rcan3 A T 4: 135,412,501 probably null Het
Rgs22 T C 15: 36,101,804 N216S probably benign Het
Rgs7bp T A 13: 104,951,582 D228V probably damaging Het
Rhobtb2 A T 14: 69,796,613 S388T probably benign Het
Rnps1 C T 17: 24,420,390 R138C unknown Het
Rpl38 T C 11: 114,671,776 V36A probably benign Het
Rps7 G T 12: 28,631,753 H126Q possibly damaging Het
Sec24b G T 3: 129,991,361 Q999K possibly damaging Het
Slc19a3 A G 1: 83,019,368 V373A possibly damaging Het
Spats2l T A 1: 57,885,782 V113E probably benign Het
Ss18l1 A T 2: 180,063,345 T377S unknown Het
Surf1 A G 2: 26,915,970 F38L probably benign Het
Ticrr G A 7: 79,675,394 R556H probably damaging Het
Tmem184b A G 15: 79,365,814 S254P probably damaging Het
Tnfrsf4 G T 4: 156,016,235 R237L possibly damaging Het
Tnk2 C A 16: 32,663,742 probably benign Het
Tnks A T 8: 34,838,530 D1191E probably damaging Het
Tnr C A 1: 159,895,037 Y1017* probably null Het
Tomm34 A G 2: 164,061,006 I128T probably benign Het
Trim2 G A 3: 84,177,792 S540F possibly damaging Het
Trio A T 15: 27,732,891 I2968N probably damaging Het
Ttc24 T C 3: 88,074,874 E17G probably benign Het
Ttc41 A G 10: 86,776,214 H1117R probably benign Het
Ttn A T 2: 76,735,408 V28200D probably damaging Het
Ttn A T 2: 76,762,386 S20801T possibly damaging Het
Ube2cbp C T 9: 86,448,787 C114Y probably damaging Het
Ugt2b37 A C 5: 87,240,857 L499R probably damaging Het
Vmn1r81 T C 7: 12,260,662 I6M possibly damaging Het
Vmn2r97 A T 17: 18,929,331 Y327F probably benign Het
Vps13b T C 15: 35,709,507 S1867P probably damaging Het
Wdr11 T C 7: 129,606,607 V362A probably benign Het
Zan T A 5: 137,388,939 M4951L unknown Het
Zcwpw1 T A 5: 137,811,622 L337Q probably damaging Het
Zfp2 A T 11: 50,899,982 D411E possibly damaging Het
Zfp628 C T 7: 4,920,768 T663I probably benign Het
Zfpm1 T A 8: 122,334,924 probably null Het
Zfyve19 T C 2: 119,211,212 S87P probably benign Het
Zswim9 T A 7: 13,260,214 K672* probably null Het
Other mutations in Espl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Espl1 APN 15 102299813 missense probably damaging 1.00
IGL00839:Espl1 APN 15 102320547 unclassified probably benign
IGL00919:Espl1 APN 15 102298629 missense probably benign 0.03
IGL01125:Espl1 APN 15 102322938 missense probably damaging 1.00
IGL01366:Espl1 APN 15 102319836 missense probably benign 0.00
IGL01488:Espl1 APN 15 102298739 missense probably benign
IGL01554:Espl1 APN 15 102313225 missense probably damaging 1.00
IGL01810:Espl1 APN 15 102298205 missense probably benign
IGL01959:Espl1 APN 15 102305662 splice site probably benign
IGL02267:Espl1 APN 15 102315664 missense probably benign 0.01
IGL02452:Espl1 APN 15 102299839 missense probably damaging 1.00
IGL02469:Espl1 APN 15 102314025 missense probably damaging 1.00
IGL02500:Espl1 APN 15 102315800 missense probably benign
IGL02630:Espl1 APN 15 102296818 missense probably benign 0.11
IGL02687:Espl1 APN 15 102313178 splice site probably benign
IGL02868:Espl1 APN 15 102313990 nonsense probably null
IGL02926:Espl1 APN 15 102299855 missense probably damaging 0.99
R0019:Espl1 UTSW 15 102306319 missense probably null 0.01
R0129:Espl1 UTSW 15 102316648 missense probably benign 0.00
R0184:Espl1 UTSW 15 102299216 missense probably benign 0.01
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0240:Espl1 UTSW 15 102312541 missense probably benign 0.00
R0267:Espl1 UTSW 15 102313017 missense possibly damaging 0.89
R0423:Espl1 UTSW 15 102303986 nonsense probably null
R0587:Espl1 UTSW 15 102303947 splice site probably benign
R0726:Espl1 UTSW 15 102322598 missense probably benign
R1186:Espl1 UTSW 15 102304039 missense probably benign 0.05
R1282:Espl1 UTSW 15 102315391 missense probably benign 0.00
R1428:Espl1 UTSW 15 102305685 missense probably benign 0.06
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1467:Espl1 UTSW 15 102319858 missense probably benign 0.09
R1473:Espl1 UTSW 15 102320443 missense possibly damaging 0.63
R1570:Espl1 UTSW 15 102298367 missense probably damaging 0.98
R1639:Espl1 UTSW 15 102320714 missense probably damaging 1.00
R1725:Espl1 UTSW 15 102313221 missense probably benign 0.08
R1748:Espl1 UTSW 15 102298529 missense possibly damaging 0.92
R1845:Espl1 UTSW 15 102299013 missense probably benign
R1954:Espl1 UTSW 15 102298388 missense probably damaging 1.00
R2009:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2014:Espl1 UTSW 15 102322714 nonsense probably null
R2067:Espl1 UTSW 15 102299090 missense probably damaging 0.96
R2084:Espl1 UTSW 15 102296851 critical splice donor site probably null
R2164:Espl1 UTSW 15 102319588 missense probably damaging 1.00
R2204:Espl1 UTSW 15 102305905 missense probably damaging 1.00
R2220:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R2237:Espl1 UTSW 15 102315569 missense probably damaging 0.98
R2314:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3107:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3108:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3114:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3115:Espl1 UTSW 15 102323204 missense possibly damaging 0.89
R3615:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3616:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3732:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3733:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3958:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3959:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R3960:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4062:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4063:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4064:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4165:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4166:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4349:Espl1 UTSW 15 102319604 missense probably benign 0.26
R4373:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4376:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4377:Espl1 UTSW 15 102312989 missense probably damaging 0.99
R4516:Espl1 UTSW 15 102323236 missense probably benign 0.00
R4595:Espl1 UTSW 15 102298724 missense probably benign 0.01
R4884:Espl1 UTSW 15 102324070 missense possibly damaging 0.84
R4894:Espl1 UTSW 15 102322323 critical splice acceptor site probably null
R4921:Espl1 UTSW 15 102315241 missense probably damaging 0.98
R4931:Espl1 UTSW 15 102305730 missense probably benign 0.02
R4936:Espl1 UTSW 15 102304937 missense probably damaging 1.00
R5000:Espl1 UTSW 15 102298551 missense probably damaging 1.00
R5220:Espl1 UTSW 15 102298577 missense probably benign 0.03
R5329:Espl1 UTSW 15 102312518 missense probably damaging 0.97
R5501:Espl1 UTSW 15 102317130 missense possibly damaging 0.51
R5788:Espl1 UTSW 15 102324030 missense probably damaging 1.00
R5848:Espl1 UTSW 15 102322576 missense probably benign 0.03
R5906:Espl1 UTSW 15 102296851 critical splice donor site probably null
R5978:Espl1 UTSW 15 102315774 missense possibly damaging 0.66
R6111:Espl1 UTSW 15 102299888 missense probably damaging 0.99
R6313:Espl1 UTSW 15 102315812 missense probably benign 0.00
R6414:Espl1 UTSW 15 102315560 missense probably damaging 0.96
R6484:Espl1 UTSW 15 102323500 missense possibly damaging 0.65
R6784:Espl1 UTSW 15 102299225 missense probably benign
R6928:Espl1 UTSW 15 102298907 missense probably benign 0.28
R6995:Espl1 UTSW 15 102304100 missense possibly damaging 0.94
R7053:Espl1 UTSW 15 102316893 critical splice donor site probably null
R7062:Espl1 UTSW 15 102298896 missense probably benign 0.00
R7135:Espl1 UTSW 15 102319524 nonsense probably null
R7154:Espl1 UTSW 15 102324049 missense probably damaging 1.00
R7164:Espl1 UTSW 15 102313203 missense probably damaging 1.00
X0062:Espl1 UTSW 15 102298397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGGCTCCCTAGTAAGATGCAG -3'
(R):5'- TGCTTAAAATGAAGGGAGCACTC -3'

Sequencing Primer
(F):5'- GCTCCCTAGTAAGATGCAGACTGTC -3'
(R):5'- TGATCCCCGTATCAGTAACACTGG -3'
Posted On2014-07-14