Incidental Mutation 'R0126:Tlr9'
ID21380
Institutional Source Beutler Lab
Gene Symbol Tlr9
Ensembl Gene ENSMUSG00000045322
Gene Nametoll-like receptor 9
Synonyms
MMRRC Submission 038411-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R0126 (G1)
Quality Score225
Status Validated (trace)
Chromosome9
Chromosomal Location106222598-106226883 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 106225682 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 724 (L724Q)
Ref Sequence ENSEMBL: ENSMUSP00000082207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062241]
PDB Structure
Crystal structure of mouse TLR9 (unliganded form) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 1) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA4084 (form 2) [X-RAY DIFFRACTION]
Crystal structure of mouse TLR9 in complex with inhibitory DNA_super [X-RAY DIFFRACTION]
Crystal Structure of the C-terminal Domain of Mouse TLR9 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000062241
AA Change: L724Q

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000082207
Gene: ENSMUSG00000045322
AA Change: L724Q

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
LRR 62 85 1.49e2 SMART
LRR 122 144 1.41e1 SMART
LRR 198 221 4.98e-1 SMART
LRR 283 306 6.59e1 SMART
LRR 307 332 1.62e1 SMART
Blast:LRR 333 361 8e-6 BLAST
LRR 390 413 7.38e1 SMART
LRR 414 440 1.86e2 SMART
LRR 496 520 1.81e2 SMART
LRR 521 544 6.05e0 SMART
LRR 545 568 2.27e2 SMART
LRR 575 599 4.58e1 SMART
LRR 628 651 3.87e1 SMART
LRR_TYP 677 700 3.39e-3 SMART
LRR 702 724 2.27e2 SMART
LRR 726 748 3.09e2 SMART
Blast:LRRCT 761 810 4e-11 BLAST
Pfam:TIR 870 1029 7.4e-11 PFAM
Meta Mutation Damage Score 0.1524 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.2%
  • 20x: 81.8%
Validation Efficiency 98% (102/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is preferentially expressed in immune cell rich tissues, such as spleen, lymph node, bone marrow and peripheral blood leukocytes. Studies in mice and human indicate that this receptor mediates cellular response to unmethylated CpG dinucleotides in bacterial DNA to mount an innate immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice exhibit impaired immune responses to CpG DNA and altered susceptibility to EAE and parasitic infection. ENU-induced mutants may exhibit altered susceptibility to viral infection or induced colitis and impaired immune response to unmethylated CpG oligonucleotides. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,443,730 L1730P possibly damaging Het
Adam9 T C 8: 24,970,737 N577S probably damaging Het
Add1 T C 5: 34,613,579 Y316H probably benign Het
Agpat3 T C 10: 78,278,056 D266G probably null Het
Aldh3a2 C A 11: 61,224,558 Q524H probably benign Het
Alox12b A C 11: 69,167,471 S550R probably benign Het
Ano4 T A 10: 88,952,292 I753F possibly damaging Het
AW011738 T A 4: 156,203,647 probably benign Het
B4galt3 C T 1: 171,276,165 T103M probably damaging Het
Cabs1 C T 5: 87,980,195 T235I probably damaging Het
Casc4 T C 2: 121,906,084 probably benign Het
Casq2 A G 3: 102,133,399 H272R probably damaging Het
Ccdc180 T C 4: 45,912,866 probably null Het
Cdh12 A T 15: 21,583,945 M624L probably benign Het
Cdh5 A C 8: 104,140,682 probably null Het
Col7a1 A G 9: 108,969,583 probably benign Het
Cpne2 A T 8: 94,554,933 I199F probably damaging Het
Crebbp A T 16: 4,084,063 F2399L possibly damaging Het
Defb36 T C 2: 152,612,579 C53R probably damaging Het
Degs1 T C 1: 182,279,692 M1V probably null Het
Disp2 T A 2: 118,790,338 F517Y probably damaging Het
Dnah5 A G 15: 28,246,319 D601G probably benign Het
Dnpep G A 1: 75,312,538 Q310* probably null Het
Dsg1a A G 18: 20,340,878 T1003A probably benign Het
Fbrsl1 C G 5: 110,396,040 probably benign Het
Foxh1 A T 15: 76,669,254 L116H probably damaging Het
Gigyf2 G A 1: 87,411,875 probably benign Het
Gp1ba A T 11: 70,641,033 probably benign Het
Gucy1b1 A G 3: 82,037,911 probably benign Het
Gucy2g T G 19: 55,241,166 D24A probably benign Het
Hirip3 A G 7: 126,863,442 K190R probably damaging Het
Hmmr T C 11: 40,705,954 N717D probably damaging Het
Il12b A T 11: 44,410,218 Y187F probably damaging Het
Iqgap1 A G 7: 80,738,322 I859T probably benign Het
Jmjd1c T C 10: 67,219,326 L175P probably damaging Het
Klc2 T C 19: 5,112,746 M242V possibly damaging Het
Klf3 T C 5: 64,822,103 M96T probably benign Het
Lrrc66 G T 5: 73,607,088 H871N probably benign Het
Ltn1 A T 16: 87,425,640 D168E probably benign Het
Mak T C 13: 41,032,596 D532G probably damaging Het
March6 A G 15: 31,462,005 M859T probably benign Het
Mlxipl C A 5: 135,132,323 N365K probably damaging Het
Mplkip T C 13: 17,695,752 S90P possibly damaging Het
Myo5c A T 9: 75,269,525 H584L probably benign Het
Myt1l A G 12: 29,851,720 T228A possibly damaging Het
Nxpe3 A T 16: 55,866,229 Y139N possibly damaging Het
Olfr1090 T A 2: 86,754,637 I34L probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr568 A G 7: 102,877,140 T7A probably benign Het
Pak6 C T 2: 118,690,332 S268F possibly damaging Het
Parp10 G A 15: 76,243,066 A57V probably damaging Het
Pik3r3 T A 4: 116,256,268 D69E probably damaging Het
Polr2a T G 11: 69,747,425 K105T probably damaging Het
Prdm16 A T 4: 154,328,838 probably benign Het
Prepl G A 17: 85,083,242 T96I probably benign Het
Ret C T 6: 118,165,995 probably benign Het
Rgl3 A T 9: 21,975,812 D541E probably benign Het
Rpa1 A C 11: 75,318,529 Y143D probably benign Het
Rps16 T A 7: 28,351,083 L47Q probably damaging Het
Sbno2 A T 10: 80,068,853 probably null Het
Scube1 A T 15: 83,621,063 N385K probably damaging Het
Shank2 A G 7: 144,031,355 E31G probably damaging Het
Slc38a9 G T 13: 112,729,257 C496F possibly damaging Het
Snap47 A G 11: 59,437,987 V163A probably damaging Het
Sntg2 T C 12: 30,201,261 probably benign Het
Sp7 C A 15: 102,358,460 V322F probably damaging Het
Spic T C 10: 88,676,062 K111E probably damaging Het
Sqor T C 2: 122,798,027 probably benign Het
St6galnac1 T A 11: 116,766,584 M385L probably benign Het
Synpo2 A T 3: 123,079,862 S1211T possibly damaging Het
Sytl2 T A 7: 90,396,589 V638E probably damaging Het
Taar1 T A 10: 23,920,547 S48T probably benign Het
Tbx18 T A 9: 87,729,653 D108V possibly damaging Het
Tdh C T 14: 63,497,593 probably benign Het
Tldc1 T C 8: 119,762,350 D398G possibly damaging Het
Tmem270 T A 5: 134,902,788 Y100F probably benign Het
Trim65 G C 11: 116,124,604 probably benign Het
Trrap A T 5: 144,805,750 K1393* probably null Het
Ttc13 A G 8: 124,683,291 V523A probably damaging Het
Utrn T A 10: 12,711,475 D939V probably benign Het
Vmn1r46 G T 6: 89,976,953 M261I probably benign Het
Vwa5a A G 9: 38,737,807 probably null Het
Zfp108 A T 7: 24,260,724 T247S probably benign Het
Zfp366 A T 13: 99,228,621 I97F probably benign Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Tlr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00864:Tlr9 APN 9 106225007 missense probably damaging 1.00
IGL01764:Tlr9 APN 9 106225805 missense probably damaging 1.00
IGL02077:Tlr9 APN 9 106225505 missense possibly damaging 0.90
IGL02232:Tlr9 APN 9 106224937 missense probably damaging 1.00
IGL02851:Tlr9 APN 9 106224730 nonsense probably null
Asura UTSW 9 106224647 missense probably damaging 1.00
cpg1 UTSW 9 106225007 missense probably damaging 1.00
Cpg11 UTSW 9 106224586 missense probably damaging 1.00
Cpg2 UTSW 9 106226465 missense probably damaging 1.00
Cpg3 UTSW 9 106224152 missense probably damaging 1.00
Cpg5 UTSW 9 106224689 missense probably damaging 1.00
Cpg6 UTSW 9 106226593 missense probably damaging 1.00
cpg7 UTSW 9 106225349 missense probably benign 0.00
Meager UTSW 9 106224139 missense probably damaging 1.00
PIT4498001:Tlr9 UTSW 9 106223522 missense probably benign 0.00
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0058:Tlr9 UTSW 9 106224965 missense possibly damaging 0.90
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0071:Tlr9 UTSW 9 106223578 missense probably benign
R0165:Tlr9 UTSW 9 106226087 missense probably benign 0.10
R0534:Tlr9 UTSW 9 106224887 missense probably benign 0.01
R0585:Tlr9 UTSW 9 106225076 missense probably benign 0.01
R1527:Tlr9 UTSW 9 106223750 missense probably benign 0.09
R1712:Tlr9 UTSW 9 106224049 missense probably damaging 1.00
R1817:Tlr9 UTSW 9 106224943 missense probably benign
R1940:Tlr9 UTSW 9 106224647 missense probably damaging 1.00
R2117:Tlr9 UTSW 9 106225337 missense probably damaging 1.00
R2656:Tlr9 UTSW 9 106223941 missense probably benign 0.05
R3700:Tlr9 UTSW 9 106224079 missense probably damaging 1.00
R4600:Tlr9 UTSW 9 106224533 missense probably damaging 1.00
R4608:Tlr9 UTSW 9 106224974 missense probably damaging 0.99
R4612:Tlr9 UTSW 9 106223807 missense probably damaging 1.00
R4959:Tlr9 UTSW 9 106224677 missense probably benign
R5173:Tlr9 UTSW 9 106225952 missense possibly damaging 0.49
R5472:Tlr9 UTSW 9 106224313 missense probably damaging 1.00
R5572:Tlr9 UTSW 9 106225637 missense possibly damaging 0.47
R5618:Tlr9 UTSW 9 106224739 missense possibly damaging 0.47
R5820:Tlr9 UTSW 9 106222707 critical splice donor site probably null
R6393:Tlr9 UTSW 9 106224937 missense probably damaging 1.00
R6397:Tlr9 UTSW 9 106225106 missense probably damaging 1.00
R6455:Tlr9 UTSW 9 106223999 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAGCCTCCGAGACAACTACCTATC -3'
(R):5'- AGTGAAAGGCCAAAGCAGTCCC -3'

Sequencing Primer
(F):5'- CTATCTTTCTTTAACTGGACCAGTC -3'
(R):5'- TCCTGCGCGAAGATGCTAC -3'
Posted On2013-04-11