Incidental Mutation 'R0126:Agpat3'
ID21385
Institutional Source Beutler Lab
Gene Symbol Agpat3
Ensembl Gene ENSMUSG00000001211
Gene Name1-acylglycerol-3-phosphate O-acyltransferase 3
SynonymsD10Jhu12e, LPAAT3
MMRRC Submission 038411-MU
Accession Numbers

NCBI RefSeq: NM_053014.3; MGI: 1336186

Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R0126 (G1)
Quality Score225
Status Validated (trace)
Chromosome10
Chromosomal Location78269178-78352489 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78278056 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 266 (D266G)
Ref Sequence ENSEMBL: ENSMUSP00000132954 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001240] [ENSMUST00000105387] [ENSMUST00000105388] [ENSMUST00000105389] [ENSMUST00000105390] [ENSMUST00000166360]
Predicted Effect probably null
Transcript: ENSMUST00000001240
AA Change: D266G

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000001240
Gene: ENSMUSG00000001211
AA Change: D266G

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105387
AA Change: D266G

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101026
Gene: ENSMUSG00000001211
AA Change: D266G

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105388
AA Change: D266G

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101027
Gene: ENSMUSG00000001211
AA Change: D266G

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105389
AA Change: D266G

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101028
Gene: ENSMUSG00000001211
AA Change: D266G

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105390
AA Change: D266G

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000101029
Gene: ENSMUSG00000001211
AA Change: D266G

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
transmembrane domain 308 330 N/A INTRINSIC
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146296
Predicted Effect probably null
Transcript: ENSMUST00000166360
AA Change: D266G

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000132954
Gene: ENSMUSG00000001211
AA Change: D266G

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
PlsC 90 212 3.14e-21 SMART
Pfam:Acyltransf_C 241 314 2.1e-29 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.2%
  • 20x: 81.8%
Validation Efficiency 98% (102/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an acyltransferase that converts lysophosphatidic acid into phosphatidic acid, which is the second step in the de novo phospholipid biosynthetic pathway. The encoded protein may be an integral membrane protein. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit male infertility with oligozoospermia, teratozoospermia. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted(2) Gene trapped(12)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,443,730 L1730P possibly damaging Het
Adam9 T C 8: 24,970,737 N577S probably damaging Het
Add1 T C 5: 34,613,579 Y316H probably benign Het
Aldh3a2 C A 11: 61,224,558 Q524H probably benign Het
Alox12b A C 11: 69,167,471 S550R probably benign Het
Ano4 T A 10: 88,952,292 I753F possibly damaging Het
AW011738 T A 4: 156,203,647 probably benign Het
B4galt3 C T 1: 171,276,165 T103M probably damaging Het
Cabs1 C T 5: 87,980,195 T235I probably damaging Het
Casc4 T C 2: 121,906,084 probably benign Het
Casq2 A G 3: 102,133,399 H272R probably damaging Het
Ccdc180 T C 4: 45,912,866 probably null Het
Cdh12 A T 15: 21,583,945 M624L probably benign Het
Cdh5 A C 8: 104,140,682 probably null Het
Col7a1 A G 9: 108,969,583 probably benign Het
Cpne2 A T 8: 94,554,933 I199F probably damaging Het
Crebbp A T 16: 4,084,063 F2399L possibly damaging Het
Defb36 T C 2: 152,612,579 C53R probably damaging Het
Degs1 T C 1: 182,279,692 M1V probably null Het
Disp2 T A 2: 118,790,338 F517Y probably damaging Het
Dnah5 A G 15: 28,246,319 D601G probably benign Het
Dnpep G A 1: 75,312,538 Q310* probably null Het
Dsg1a A G 18: 20,340,878 T1003A probably benign Het
Fbrsl1 C G 5: 110,396,040 probably benign Het
Foxh1 A T 15: 76,669,254 L116H probably damaging Het
Gigyf2 G A 1: 87,411,875 probably benign Het
Gp1ba A T 11: 70,641,033 probably benign Het
Gucy1b1 A G 3: 82,037,911 probably benign Het
Gucy2g T G 19: 55,241,166 D24A probably benign Het
Hirip3 A G 7: 126,863,442 K190R probably damaging Het
Hmmr T C 11: 40,705,954 N717D probably damaging Het
Il12b A T 11: 44,410,218 Y187F probably damaging Het
Iqgap1 A G 7: 80,738,322 I859T probably benign Het
Jmjd1c T C 10: 67,219,326 L175P probably damaging Het
Klc2 T C 19: 5,112,746 M242V possibly damaging Het
Klf3 T C 5: 64,822,103 M96T probably benign Het
Lrrc66 G T 5: 73,607,088 H871N probably benign Het
Ltn1 A T 16: 87,425,640 D168E probably benign Het
Mak T C 13: 41,032,596 D532G probably damaging Het
March6 A G 15: 31,462,005 M859T probably benign Het
Mlxipl C A 5: 135,132,323 N365K probably damaging Het
Mplkip T C 13: 17,695,752 S90P possibly damaging Het
Myo5c A T 9: 75,269,525 H584L probably benign Het
Myt1l A G 12: 29,851,720 T228A possibly damaging Het
Nxpe3 A T 16: 55,866,229 Y139N possibly damaging Het
Olfr1090 T A 2: 86,754,637 I34L probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr568 A G 7: 102,877,140 T7A probably benign Het
Pak6 C T 2: 118,690,332 S268F possibly damaging Het
Parp10 G A 15: 76,243,066 A57V probably damaging Het
Pik3r3 T A 4: 116,256,268 D69E probably damaging Het
Polr2a T G 11: 69,747,425 K105T probably damaging Het
Prdm16 A T 4: 154,328,838 probably benign Het
Prepl G A 17: 85,083,242 T96I probably benign Het
Ret C T 6: 118,165,995 probably benign Het
Rgl3 A T 9: 21,975,812 D541E probably benign Het
Rpa1 A C 11: 75,318,529 Y143D probably benign Het
Rps16 T A 7: 28,351,083 L47Q probably damaging Het
Sbno2 A T 10: 80,068,853 probably null Het
Scube1 A T 15: 83,621,063 N385K probably damaging Het
Shank2 A G 7: 144,031,355 E31G probably damaging Het
Slc38a9 G T 13: 112,729,257 C496F possibly damaging Het
Snap47 A G 11: 59,437,987 V163A probably damaging Het
Sntg2 T C 12: 30,201,261 probably benign Het
Sp7 C A 15: 102,358,460 V322F probably damaging Het
Spic T C 10: 88,676,062 K111E probably damaging Het
Sqor T C 2: 122,798,027 probably benign Het
St6galnac1 T A 11: 116,766,584 M385L probably benign Het
Synpo2 A T 3: 123,079,862 S1211T possibly damaging Het
Sytl2 T A 7: 90,396,589 V638E probably damaging Het
Taar1 T A 10: 23,920,547 S48T probably benign Het
Tbx18 T A 9: 87,729,653 D108V possibly damaging Het
Tdh C T 14: 63,497,593 probably benign Het
Tldc1 T C 8: 119,762,350 D398G possibly damaging Het
Tlr9 T A 9: 106,225,682 L724Q probably benign Het
Tmem270 T A 5: 134,902,788 Y100F probably benign Het
Trim65 G C 11: 116,124,604 probably benign Het
Trrap A T 5: 144,805,750 K1393* probably null Het
Ttc13 A G 8: 124,683,291 V523A probably damaging Het
Utrn T A 10: 12,711,475 D939V probably benign Het
Vmn1r46 G T 6: 89,976,953 M261I probably benign Het
Vwa5a A G 9: 38,737,807 probably null Het
Zfp108 A T 7: 24,260,724 T247S probably benign Het
Zfp366 A T 13: 99,228,621 I97F probably benign Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Agpat3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Agpat3 APN 10 78273682 utr 3 prime probably benign
IGL02621:Agpat3 APN 10 78285066 missense probably damaging 1.00
IGL02725:Agpat3 APN 10 78278055 missense probably benign 0.02
P0008:Agpat3 UTSW 10 78287876 missense probably damaging 1.00
PIT4445001:Agpat3 UTSW 10 78274093 missense possibly damaging 0.94
R0041:Agpat3 UTSW 10 78288047 unclassified probably benign
R0226:Agpat3 UTSW 10 78278029 missense possibly damaging 0.89
R1520:Agpat3 UTSW 10 78288023 start codon destroyed probably null 1.00
R2118:Agpat3 UTSW 10 78278084 missense probably damaging 1.00
R5493:Agpat3 UTSW 10 78284235 missense possibly damaging 0.89
R5599:Agpat3 UTSW 10 78274269 missense probably benign 0.39
R6280:Agpat3 UTSW 10 78285038 missense probably damaging 1.00
X0003:Agpat3 UTSW 10 78274173 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTAAGGCAGGTGAGTACCACCAG -3'
(R):5'- ACAAGGGTTCCCAGACATAGAGGC -3'

Sequencing Primer
(F):5'- CAGGTGAGTACCACCAGTCTTTG -3'
(R):5'- TGACCATGCCTAGAAGGTTC -3'
Posted On2013-04-11