Incidental Mutation 'R1940:Cdh7'
ID213872
Institutional Source Beutler Lab
Gene Symbol Cdh7
Ensembl Gene ENSMUSG00000026312
Gene Namecadherin 7, type 2
SynonymsCDH7L1
MMRRC Submission 039958-MU
Accession Numbers

Ncbi RefSeq: NM_172853.2; MGI:2442792

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1940 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location109982431-110140157 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 110049024 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 140 (V140I)
Ref Sequence ENSEMBL: ENSMUSP00000129715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027542] [ENSMUST00000112701] [ENSMUST00000131464] [ENSMUST00000172005]
Predicted Effect probably benign
Transcript: ENSMUST00000027542
AA Change: V140I

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000027542
Gene: ENSMUSG00000026312
AA Change: V140I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 633 778 6e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112701
AA Change: V140I

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000108321
Gene: ENSMUSG00000026312
AA Change: V140I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 631 779 4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131464
SMART Domains Protein: ENSMUSP00000138046
Gene: ENSMUSG00000026312

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
PDB:1ZVN|B 49 70 1e-9 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000172005
AA Change: V140I

PolyPhen 2 Score 0.089 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000129715
Gene: ENSMUSG00000026312
AA Change: V140I

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
CA 70 151 5.77e-16 SMART
CA 175 260 2.9e-30 SMART
CA 284 376 1.96e-18 SMART
CA 399 480 1.19e-26 SMART
CA 503 590 2.26e-9 SMART
transmembrane domain 606 628 N/A INTRINSIC
Pfam:Cadherin_C 631 779 4e-58 PFAM
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency 98% (108/110)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Alternative splicing results in multiple transcript variants encoding different isoforms. This gene is located adjacent to a related cadherin gene on chromosome 1. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(1) : Targeted(1)

Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,233,852 S2496R probably damaging Het
Abca16 T C 7: 120,433,609 probably benign Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adam24 A T 8: 40,681,361 R623* probably null Het
Agbl2 T A 2: 90,811,282 L752Q probably damaging Het
Ankrd26 A T 6: 118,511,693 F1335Y probably damaging Het
Ankrd34a A G 3: 96,598,676 S399G probably benign Het
Ap3d1 G A 10: 80,709,773 P1041S probably benign Het
Arid3b A T 9: 57,796,148 M466K possibly damaging Het
Arsj T C 3: 126,438,346 I247T probably damaging Het
AU016765 G A 17: 64,519,878 noncoding transcript Het
Azin2 C T 4: 128,950,784 probably null Het
Bcat2 T C 7: 45,588,368 Y313H possibly damaging Het
Cables2 A G 2: 180,260,080 V465A probably damaging Het
Ccdc60 G A 5: 116,126,165 H517Y probably damaging Het
Cd55b A T 1: 130,418,106 probably null Het
Cdc40 G A 10: 40,883,071 probably benign Het
Cfi T C 3: 129,858,828 probably benign Het
Chit1 G A 1: 134,145,418 probably null Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Ciao1 A G 2: 127,246,460 S148P possibly damaging Het
Clmn G A 12: 104,790,102 T163I probably damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Col19a1 A T 1: 24,264,750 C1117* probably null Het
Cyp2d10 T A 15: 82,405,294 I206F probably benign Het
Ddrgk1 G T 2: 130,663,560 probably benign Het
Ddx18 A T 1: 121,555,224 V611D probably damaging Het
Dnah8 A T 17: 30,731,207 H2000L probably damaging Het
Duox1 T C 2: 122,325,984 V464A probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eif4enif1 A G 11: 3,243,279 H857R probably damaging Het
Elmo2 A G 2: 165,292,050 probably benign Het
Fam171b CCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGC 2: 83,812,874 probably benign Het
Glrx A G 13: 75,840,137 I57V probably benign Het
Gm281 A T 14: 13,828,582 M726K probably null Het
Golm1 A T 13: 59,642,237 probably benign Het
Grm3 G A 5: 9,511,682 R723W probably damaging Het
Gsta3 G A 1: 21,257,377 R45Q probably benign Het
Gtf3c3 A C 1: 54,428,958 probably benign Het
Hk3 C T 13: 55,011,391 V451I probably damaging Het
Hoxa10 C A 6: 52,234,370 G189C possibly damaging Het
Hs3st3b1 T C 11: 63,889,743 D186G probably benign Het
Hscb G T 5: 110,836,060 H63N probably benign Het
Itpr3 A G 17: 27,111,217 E1603G probably damaging Het
Ivl T A 3: 92,572,749 H3L probably benign Het
Klhl26 C A 8: 70,452,261 R252L probably damaging Het
Krt31 T A 11: 100,048,243 T251S probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lhx3 T C 2: 26,203,962 D83G probably benign Het
Lss C A 10: 76,545,462 N427K possibly damaging Het
Mettl24 G A 10: 40,737,726 A154T probably benign Het
Mgat4a A T 1: 37,536,037 probably null Het
Moxd2 C T 6: 40,883,532 R326Q probably damaging Het
Mpdz G A 4: 81,361,443 A669V probably benign Het
Msra G A 14: 64,285,056 probably benign Het
Muc13 A T 16: 33,807,911 T344S probably benign Het
Myo3b T C 2: 70,258,075 I866T probably benign Het
Nbea T C 3: 55,953,100 S1852G possibly damaging Het
Ncf2 A G 1: 152,834,064 probably benign Het
Nfyc C A 4: 120,773,664 probably benign Het
Nop2 T C 6: 125,134,634 V110A probably benign Het
Nrg2 C A 18: 36,196,844 probably benign Het
Nrl A G 14: 55,522,435 Y12H probably damaging Het
Nrxn3 T C 12: 89,260,381 V635A probably damaging Het
Olfr1014 T A 2: 85,777,171 S196T probably benign Het
Olfr1415 T A 1: 92,491,735 T7S probably benign Het
Olfr1423 A C 19: 12,035,911 V277G probably benign Het
Olfr228 T A 2: 86,483,359 K128* probably null Het
Papolg A T 11: 23,867,279 N639K probably benign Het
Paqr4 T C 17: 23,737,664 I242V probably damaging Het
Pramel6 A T 2: 87,508,732 K92M probably damaging Het
Prg4 T C 1: 150,456,023 T300A possibly damaging Het
Ptprb A T 10: 116,319,610 probably benign Het
Rab28 A T 5: 41,625,790 S216T probably benign Het
Rrp1b A T 17: 32,056,845 R455S possibly damaging Het
Sash1 A T 10: 8,729,932 M898K probably benign Het
Scn8a C T 15: 100,970,204 T310I probably benign Het
Secisbp2l C A 2: 125,740,339 D1066Y probably damaging Het
Sipa1l2 A G 8: 125,480,148 probably benign Het
Slc12a1 A G 2: 125,194,193 T662A probably benign Het
Slc12a4 T C 8: 105,946,037 I749V probably benign Het
Slc22a27 A G 19: 7,909,727 S266P probably damaging Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slit1 T A 19: 41,630,776 N762I probably damaging Het
Spata31d1b C A 13: 59,718,021 D994E possibly damaging Het
Sphk1 A G 11: 116,535,850 I204V probably benign Het
Srsf6 C T 2: 162,934,483 probably benign Het
Svs1 A T 6: 48,990,073 K652* probably null Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Tgfbi A T 13: 56,614,314 Q70L possibly damaging Het
Tlr9 T C 9: 106,224,647 L379P probably damaging Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Tra2b A G 16: 22,255,045 probably benign Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Trnau1ap A G 4: 132,321,803 Y30H probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ush2a A G 1: 188,951,561 D4979G probably null Het
Usp50 C T 2: 126,778,023 R123Q probably benign Het
Vmn2r117 A T 17: 23,477,480 Y318N probably damaging Het
Whamm C T 7: 81,578,299 T304I probably null Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Ythdf3 A G 3: 16,205,092 N468D possibly damaging Het
Zbtb17 T C 4: 141,465,548 I486T possibly damaging Het
Zfp3 T C 11: 70,771,376 S54P probably benign Het
Zscan10 A T 17: 23,609,852 H379L probably damaging Het
Other mutations in Cdh7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Cdh7 APN 1 110065626 missense probably benign 0.22
IGL00861:Cdh7 APN 1 110060988 splice site probably benign
IGL01016:Cdh7 APN 1 110108956 critical splice donor site probably null
IGL01538:Cdh7 APN 1 110061140 missense probably damaging 1.00
IGL01763:Cdh7 APN 1 110065790 missense probably benign 0.00
IGL01765:Cdh7 APN 1 110061106 missense probably damaging 1.00
IGL01937:Cdh7 APN 1 110138096 missense probably benign
IGL02020:Cdh7 APN 1 110138348 missense probably damaging 1.00
IGL02135:Cdh7 APN 1 110138274 nonsense probably null
IGL02285:Cdh7 APN 1 110138191 missense probably damaging 1.00
IGL03237:Cdh7 APN 1 110138307 missense possibly damaging 0.89
IGL03280:Cdh7 APN 1 110108768 nonsense probably null
IGL03347:Cdh7 APN 1 110138243 missense possibly damaging 0.53
IGL03385:Cdh7 APN 1 110065786 missense possibly damaging 0.90
IGL02802:Cdh7 UTSW 1 110137925 missense probably damaging 1.00
R0030:Cdh7 UTSW 1 110138068 nonsense probably null
R0070:Cdh7 UTSW 1 110098372 missense probably benign 0.37
R0070:Cdh7 UTSW 1 110098372 missense probably benign 0.37
R0255:Cdh7 UTSW 1 109994306 missense probably benign 0.09
R0365:Cdh7 UTSW 1 110108756 missense probably damaging 1.00
R0506:Cdh7 UTSW 1 110100114 missense probably damaging 1.00
R0549:Cdh7 UTSW 1 110108944 missense probably damaging 1.00
R0599:Cdh7 UTSW 1 110052966 missense probably damaging 1.00
R0648:Cdh7 UTSW 1 110065607 splice site probably benign
R1033:Cdh7 UTSW 1 110085053 missense probably damaging 0.96
R1173:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1174:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1175:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1403:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1403:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1406:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1406:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1587:Cdh7 UTSW 1 110100027 missense probably damaging 0.98
R1728:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1729:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1730:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1739:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1762:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1769:Cdh7 UTSW 1 110052876 missense probably damaging 1.00
R1783:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1785:Cdh7 UTSW 1 110065735 missense possibly damaging 0.53
R1972:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1973:Cdh7 UTSW 1 110061132 missense probably benign 0.10
R1997:Cdh7 UTSW 1 110048938 missense probably damaging 1.00
R2060:Cdh7 UTSW 1 110048877 missense probably damaging 1.00
R2068:Cdh7 UTSW 1 110137936 nonsense probably null
R2069:Cdh7 UTSW 1 110138159 missense probably damaging 1.00
R2137:Cdh7 UTSW 1 110100106 missense probably damaging 0.97
R2155:Cdh7 UTSW 1 110048864 missense probably damaging 1.00
R3780:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R3781:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R3782:Cdh7 UTSW 1 110049004 missense probably benign 0.45
R4115:Cdh7 UTSW 1 110138309 missense probably benign 0.37
R4277:Cdh7 UTSW 1 110065688 missense probably benign 0.00
R4299:Cdh7 UTSW 1 110061001 missense probably damaging 0.99
R4777:Cdh7 UTSW 1 109994325 nonsense probably null
R4907:Cdh7 UTSW 1 110138323 missense probably damaging 1.00
R5045:Cdh7 UTSW 1 110098350 missense probably benign 0.01
R5059:Cdh7 UTSW 1 110065700 missense probably damaging 0.98
R5146:Cdh7 UTSW 1 109994312 missense probably damaging 0.97
R5196:Cdh7 UTSW 1 110138000 missense probably damaging 0.99
R5304:Cdh7 UTSW 1 110108839 missense probably damaging 1.00
R5496:Cdh7 UTSW 1 110048917 missense probably damaging 1.00
R5743:Cdh7 UTSW 1 110108845 missense probably damaging 1.00
R5867:Cdh7 UTSW 1 110048851 missense probably damaging 1.00
R6042:Cdh7 UTSW 1 110138267 missense probably damaging 0.97
R6092:Cdh7 UTSW 1 110098306 missense probably benign 0.00
R6497:Cdh7 UTSW 1 110065798 critical splice donor site probably null
R7111:Cdh7 UTSW 1 110137908 missense
Z1088:Cdh7 UTSW 1 110085123 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAAGTACATCTTGTCAGGCGAAG -3'
(R):5'- TTTTCCAAACCTTCCAACTGGG -3'

Sequencing Primer
(F):5'- CGAAGGGGCAAGTTCAATTTTC -3'
(R):5'- CCTTCCAACTGGGTAAATGAAGATG -3'
Posted On2014-07-14