Incidental Mutation 'R1940:Elmo2'
ID213896
Institutional Source Beutler Lab
Gene Symbol Elmo2
Ensembl Gene ENSMUSG00000017670
Gene Nameengulfment and cell motility 2
SynonymsCED-12, 1190002F24Rik
MMRRC Submission 039958-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R1940 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location165288031-165326479 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 165292050 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000116288 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017808] [ENSMUST00000071699] [ENSMUST00000074046] [ENSMUST00000094329] [ENSMUST00000103088] [ENSMUST00000103091] [ENSMUST00000109298] [ENSMUST00000109299] [ENSMUST00000109300] [ENSMUST00000130393] [ENSMUST00000131409] [ENSMUST00000132270] [ENSMUST00000133961] [ENSMUST00000156134]
Predicted Effect probably benign
Transcript: ENSMUST00000017808
SMART Domains Protein: ENSMUSP00000017808
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
Pfam:UAA 15 320 3.5e-10 PFAM
Pfam:TPT 165 315 6.9e-37 PFAM
low complexity region 339 356 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000071699
AA Change: S673P
SMART Domains Protein: ENSMUSP00000071619
Gene: ENSMUSG00000017670
AA Change: S673P

DomainStartEndE-ValueType
Pfam:DUF3361 115 272 1.6e-61 PFAM
Pfam:ELMO_CED12 295 474 3.2e-39 PFAM
Pfam:PH_12 541 657 5.4e-33 PFAM
internal_repeat_1 670 688 6.69e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000074046
SMART Domains Protein: ENSMUSP00000073691
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 285 2.7e-75 PFAM
Pfam:ELMO_CED12 304 487 3.7e-48 PFAM
PDB:3A98|D 535 729 3e-99 PDB
SCOP:d1mai__ 552 677 4e-33 SMART
Blast:PH 560 681 2e-82 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000094329
SMART Domains Protein: ENSMUSP00000091887
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 5.6e-77 PFAM
Pfam:ELMO_CED12 292 475 3.6e-48 PFAM
PDB:3A98|D 523 717 2e-99 PDB
SCOP:d1mai__ 540 665 5e-33 SMART
Blast:PH 548 669 1e-82 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000103088
AA Change: S673P
SMART Domains Protein: ENSMUSP00000099377
Gene: ENSMUSG00000017670
AA Change: S673P

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 6.6e-77 PFAM
Pfam:ELMO_CED12 292 475 4.3e-48 PFAM
internal_repeat_1 654 672 6.69e-7 PROSPERO
internal_repeat_1 670 688 6.69e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000103091
SMART Domains Protein: ENSMUSP00000099380
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:DUF3361 114 273 5.6e-77 PFAM
Pfam:ELMO_CED12 292 475 3.6e-48 PFAM
PDB:3A98|D 523 717 2e-99 PDB
SCOP:d1mai__ 540 665 5e-33 SMART
Blast:PH 548 669 1e-82 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000109298
SMART Domains Protein: ENSMUSP00000104921
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
Pfam:UAA 15 320 3.5e-10 PFAM
Pfam:TPT 165 315 6.9e-37 PFAM
low complexity region 339 356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109299
SMART Domains Protein: ENSMUSP00000104922
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
Pfam:UAA 15 320 3.5e-10 PFAM
Pfam:TPT 165 315 6.9e-37 PFAM
low complexity region 339 356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109300
SMART Domains Protein: ENSMUSP00000104923
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
Pfam:TPT 15 314 2.7e-27 PFAM
Pfam:EamA 164 315 1.6e-8 PFAM
low complexity region 339 356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130393
SMART Domains Protein: ENSMUSP00000123450
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000131409
SMART Domains Protein: ENSMUSP00000120036
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132270
SMART Domains Protein: ENSMUSP00000125708
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133961
SMART Domains Protein: ENSMUSP00000118227
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
Pfam:UAA 15 188 9e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147247
Predicted Effect probably benign
Transcript: ENSMUST00000148643
SMART Domains Protein: ENSMUSP00000117124
Gene: ENSMUSG00000017670

DomainStartEndE-ValueType
Pfam:ELMO_CED12 2 48 9.6e-10 PFAM
Pfam:PH_12 115 237 1.3e-35 PFAM
low complexity region 270 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156134
SMART Domains Protein: ENSMUSP00000116288
Gene: ENSMUSG00000017664

DomainStartEndE-ValueType
Pfam:UAA 15 188 9e-9 PFAM
Meta Mutation Damage Score 0.094 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency 98% (108/110)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the dedicator of cyto-kinesis 1 protein. Similarity to a C. elegans protein suggests that this protein may function in phagocytosis of apoptotic cells and in cell migration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,233,852 S2496R probably damaging Het
Abca16 T C 7: 120,433,609 probably benign Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adam24 A T 8: 40,681,361 R623* probably null Het
Agbl2 T A 2: 90,811,282 L752Q probably damaging Het
Ankrd26 A T 6: 118,511,693 F1335Y probably damaging Het
Ankrd34a A G 3: 96,598,676 S399G probably benign Het
Ap3d1 G A 10: 80,709,773 P1041S probably benign Het
Arid3b A T 9: 57,796,148 M466K possibly damaging Het
Arsj T C 3: 126,438,346 I247T probably damaging Het
AU016765 G A 17: 64,519,878 noncoding transcript Het
Azin2 C T 4: 128,950,784 probably null Het
Bcat2 T C 7: 45,588,368 Y313H possibly damaging Het
Cables2 A G 2: 180,260,080 V465A probably damaging Het
Ccdc60 G A 5: 116,126,165 H517Y probably damaging Het
Cd55b A T 1: 130,418,106 probably null Het
Cdc40 G A 10: 40,883,071 probably benign Het
Cdh7 G A 1: 110,049,024 V140I probably benign Het
Cfi T C 3: 129,858,828 probably benign Het
Chit1 G A 1: 134,145,418 probably null Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Ciao1 A G 2: 127,246,460 S148P possibly damaging Het
Clmn G A 12: 104,790,102 T163I probably damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Col19a1 A T 1: 24,264,750 C1117* probably null Het
Cyp2d10 T A 15: 82,405,294 I206F probably benign Het
Ddrgk1 G T 2: 130,663,560 probably benign Het
Ddx18 A T 1: 121,555,224 V611D probably damaging Het
Dnah8 A T 17: 30,731,207 H2000L probably damaging Het
Duox1 T C 2: 122,325,984 V464A probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eif4enif1 A G 11: 3,243,279 H857R probably damaging Het
Fam171b CCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGC 2: 83,812,874 probably benign Het
Glrx A G 13: 75,840,137 I57V probably benign Het
Gm281 A T 14: 13,828,582 M726K probably null Het
Golm1 A T 13: 59,642,237 probably benign Het
Grm3 G A 5: 9,511,682 R723W probably damaging Het
Gsta3 G A 1: 21,257,377 R45Q probably benign Het
Gtf3c3 A C 1: 54,428,958 probably benign Het
Hk3 C T 13: 55,011,391 V451I probably damaging Het
Hoxa10 C A 6: 52,234,370 G189C possibly damaging Het
Hs3st3b1 T C 11: 63,889,743 D186G probably benign Het
Hscb G T 5: 110,836,060 H63N probably benign Het
Itpr3 A G 17: 27,111,217 E1603G probably damaging Het
Ivl T A 3: 92,572,749 H3L probably benign Het
Klhl26 C A 8: 70,452,261 R252L probably damaging Het
Krt31 T A 11: 100,048,243 T251S probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lhx3 T C 2: 26,203,962 D83G probably benign Het
Lss C A 10: 76,545,462 N427K possibly damaging Het
Mettl24 G A 10: 40,737,726 A154T probably benign Het
Mgat4a A T 1: 37,536,037 probably null Het
Moxd2 C T 6: 40,883,532 R326Q probably damaging Het
Mpdz G A 4: 81,361,443 A669V probably benign Het
Msra G A 14: 64,285,056 probably benign Het
Muc13 A T 16: 33,807,911 T344S probably benign Het
Myo3b T C 2: 70,258,075 I866T probably benign Het
Nbea T C 3: 55,953,100 S1852G possibly damaging Het
Ncf2 A G 1: 152,834,064 probably benign Het
Nfyc C A 4: 120,773,664 probably benign Het
Nop2 T C 6: 125,134,634 V110A probably benign Het
Nrg2 C A 18: 36,196,844 probably benign Het
Nrl A G 14: 55,522,435 Y12H probably damaging Het
Nrxn3 T C 12: 89,260,381 V635A probably damaging Het
Olfr1014 T A 2: 85,777,171 S196T probably benign Het
Olfr1415 T A 1: 92,491,735 T7S probably benign Het
Olfr1423 A C 19: 12,035,911 V277G probably benign Het
Olfr228 T A 2: 86,483,359 K128* probably null Het
Papolg A T 11: 23,867,279 N639K probably benign Het
Paqr4 T C 17: 23,737,664 I242V probably damaging Het
Pramel6 A T 2: 87,508,732 K92M probably damaging Het
Prg4 T C 1: 150,456,023 T300A possibly damaging Het
Ptprb A T 10: 116,319,610 probably benign Het
Rab28 A T 5: 41,625,790 S216T probably benign Het
Rrp1b A T 17: 32,056,845 R455S possibly damaging Het
Sash1 A T 10: 8,729,932 M898K probably benign Het
Scn8a C T 15: 100,970,204 T310I probably benign Het
Secisbp2l C A 2: 125,740,339 D1066Y probably damaging Het
Sipa1l2 A G 8: 125,480,148 probably benign Het
Slc12a1 A G 2: 125,194,193 T662A probably benign Het
Slc12a4 T C 8: 105,946,037 I749V probably benign Het
Slc22a27 A G 19: 7,909,727 S266P probably damaging Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slit1 T A 19: 41,630,776 N762I probably damaging Het
Spata31d1b C A 13: 59,718,021 D994E possibly damaging Het
Sphk1 A G 11: 116,535,850 I204V probably benign Het
Srsf6 C T 2: 162,934,483 probably benign Het
Svs1 A T 6: 48,990,073 K652* probably null Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Tgfbi A T 13: 56,614,314 Q70L possibly damaging Het
Tlr9 T C 9: 106,224,647 L379P probably damaging Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Tra2b A G 16: 22,255,045 probably benign Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Trnau1ap A G 4: 132,321,803 Y30H probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ush2a A G 1: 188,951,561 D4979G probably null Het
Usp50 C T 2: 126,778,023 R123Q probably benign Het
Vmn2r117 A T 17: 23,477,480 Y318N probably damaging Het
Whamm C T 7: 81,578,299 T304I probably null Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Ythdf3 A G 3: 16,205,092 N468D possibly damaging Het
Zbtb17 T C 4: 141,465,548 I486T possibly damaging Het
Zfp3 T C 11: 70,771,376 S54P probably benign Het
Zscan10 A T 17: 23,609,852 H379L probably damaging Het
Other mutations in Elmo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Elmo2 APN 2 165292014 unclassified probably benign
IGL01096:Elmo2 APN 2 165296987 unclassified probably benign
IGL01694:Elmo2 APN 2 165314773 missense probably benign 0.05
IGL02016:Elmo2 APN 2 165295012 critical splice donor site probably null
IGL02402:Elmo2 APN 2 165297392 missense probably damaging 0.97
IGL02808:Elmo2 APN 2 165291707 unclassified probably benign
IGL03030:Elmo2 APN 2 165294317 missense possibly damaging 0.93
IGL03117:Elmo2 APN 2 165298653 missense probably benign 0.01
R0046:Elmo2 UTSW 2 165298726 missense probably damaging 0.97
R0046:Elmo2 UTSW 2 165298726 missense probably damaging 0.97
R0278:Elmo2 UTSW 2 165297367 missense probably damaging 1.00
R0281:Elmo2 UTSW 2 165296890 missense probably damaging 1.00
R0472:Elmo2 UTSW 2 165298330 missense probably damaging 0.99
R0570:Elmo2 UTSW 2 165304919 missense probably benign 0.38
R1799:Elmo2 UTSW 2 165292157 missense probably damaging 1.00
R2005:Elmo2 UTSW 2 165298279 missense probably benign 0.00
R2504:Elmo2 UTSW 2 165298687 missense probably damaging 0.96
R2915:Elmo2 UTSW 2 165297653 unclassified probably benign
R3744:Elmo2 UTSW 2 165316002 missense probably damaging 0.96
R4027:Elmo2 UTSW 2 165294249 nonsense probably null
R4419:Elmo2 UTSW 2 165311755 unclassified probably null
R4824:Elmo2 UTSW 2 165292002 unclassified probably benign
R4888:Elmo2 UTSW 2 165295289 missense probably benign 0.14
R4950:Elmo2 UTSW 2 165314813 unclassified probably null
R5157:Elmo2 UTSW 2 165291707 unclassified probably benign
R5535:Elmo2 UTSW 2 165310212 missense possibly damaging 0.51
R5682:Elmo2 UTSW 2 165297410 missense probably damaging 1.00
R5840:Elmo2 UTSW 2 165295552 missense possibly damaging 0.64
R5868:Elmo2 UTSW 2 165294272 missense possibly damaging 0.89
R7022:Elmo2 UTSW 2 165295041 missense probably damaging 0.99
R7089:Elmo2 UTSW 2 165304929 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- GCTGCTCTAAGGCACAAAGTG -3'
(R):5'- TTGGTGACATCATAACCAGGC -3'

Sequencing Primer
(F):5'- GTGGCGCAAAGTTCTAATCC -3'
(R):5'- GGCACTGCTCCAAGTCACTC -3'
Posted On2014-07-14