Incidental Mutation 'R0126:Gp1ba'
ID21395
Institutional Source Beutler Lab
Gene Symbol Gp1ba
Ensembl Gene ENSMUSG00000050675
Gene Nameglycoprotein 1b, alpha polypeptide
SynonymsGP Ib-alpha, GPIb-alpha, GPIba
MMRRC Submission 038411-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R0126 (G1)
Quality Score225
Status Validated (trace)
Chromosome11
Chromosomal Location70639122-70642036 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 70641033 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014750] [ENSMUST00000055184] [ENSMUST00000108551] [ENSMUST00000136383] [ENSMUST00000139638]
Predicted Effect probably benign
Transcript: ENSMUST00000014750
SMART Domains Protein: ENSMUSP00000014750
Gene: ENSMUSG00000014606

DomainStartEndE-ValueType
Pfam:Mito_carr 18 112 1.3e-22 PFAM
Pfam:Mito_carr 115 213 2.6e-19 PFAM
Pfam:Mito_carr 216 311 5.2e-21 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000055184
AA Change: T542S
SMART Domains Protein: ENSMUSP00000057563
Gene: ENSMUSG00000050675
AA Change: T542S

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRRNT 19 51 1.66e-1 SMART
LRR 70 91 2.54e2 SMART
LRR 92 114 9.96e-1 SMART
LRR_TYP 115 138 1.56e-2 SMART
LRR_TYP 139 162 1.47e-3 SMART
LRR 163 186 1.89e-1 SMART
LRR 187 210 8.09e-1 SMART
LRRCT 221 281 2.53e-12 SMART
low complexity region 403 432 N/A INTRINSIC
low complexity region 446 530 N/A INTRINSIC
low complexity region 533 579 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
PDB:2BP3|T 680 701 2e-6 PDB
Predicted Effect unknown
Transcript: ENSMUST00000108551
AA Change: T542S
SMART Domains Protein: ENSMUSP00000104191
Gene: ENSMUSG00000050675
AA Change: T542S

DomainStartEndE-ValueType
low complexity region 3 14 N/A INTRINSIC
LRRNT 19 51 1.66e-1 SMART
LRR 70 91 2.54e2 SMART
LRR 92 114 9.96e-1 SMART
LRR_TYP 115 138 1.56e-2 SMART
LRR_TYP 139 162 1.47e-3 SMART
LRR 163 186 1.89e-1 SMART
LRR 187 210 8.09e-1 SMART
LRRCT 221 281 2.53e-12 SMART
low complexity region 403 432 N/A INTRINSIC
low complexity region 446 530 N/A INTRINSIC
low complexity region 533 579 N/A INTRINSIC
transmembrane domain 612 634 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
PDB:2BP3|T 680 701 2e-6 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134804
Predicted Effect probably benign
Transcript: ENSMUST00000136383
SMART Domains Protein: ENSMUSP00000120900
Gene: ENSMUSG00000014606

DomainStartEndE-ValueType
Pfam:Mito_carr 1 75 9.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139638
SMART Domains Protein: ENSMUSP00000114685
Gene: ENSMUSG00000014606

DomainStartEndE-ValueType
Pfam:Mito_carr 1 80 7.4e-17 PFAM
Pfam:Mito_carr 83 181 1.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157076
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.2%
  • 20x: 81.8%
Validation Efficiency 98% (102/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycoprotein Ib (GP Ib) is a platelet surface membrane glycoprotein composed of a heterodimer, an alpha chain and a beta chain, that is linked by disulfide bonds. The Gp Ib functions as a receptor for von Willebrand factor (VWF). The complete receptor complex includes noncovalent association of the alpha and beta subunits with platelet glycoprotein IX and platelet glycoprotein V. The binding of the GP Ib-IX-V complex to VWF facilitates initial platelet adhesion to vascular subendothelium after vascular injury, and also initiates signaling events within the platelet that lead to enhanced platelet activation, thrombosis, and hemostasis. This gene encodes the alpha subunit. Mutations in this gene result in Bernard-Soulier syndromes and platelet-type von Willebrand disease. The coding region of this gene is known to contain a polymophic variable number tandem repeat (VNTR) domain that is associated with susceptibility to nonarteritic anterior ischemic optic neuropathy. [provided by RefSeq, Oct 2013]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit prolonged bleeding times and reduced numbers of enlarged platelets. Heterozygotes have intermediate numbers of platelets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,443,730 L1730P possibly damaging Het
Adam9 T C 8: 24,970,737 N577S probably damaging Het
Add1 T C 5: 34,613,579 Y316H probably benign Het
Agpat3 T C 10: 78,278,056 D266G probably null Het
Aldh3a2 C A 11: 61,224,558 Q524H probably benign Het
Alox12b A C 11: 69,167,471 S550R probably benign Het
Ano4 T A 10: 88,952,292 I753F possibly damaging Het
AW011738 T A 4: 156,203,647 probably benign Het
B4galt3 C T 1: 171,276,165 T103M probably damaging Het
Cabs1 C T 5: 87,980,195 T235I probably damaging Het
Casc4 T C 2: 121,906,084 probably benign Het
Casq2 A G 3: 102,133,399 H272R probably damaging Het
Ccdc180 T C 4: 45,912,866 probably null Het
Cdh12 A T 15: 21,583,945 M624L probably benign Het
Cdh5 A C 8: 104,140,682 probably null Het
Col7a1 A G 9: 108,969,583 probably benign Het
Cpne2 A T 8: 94,554,933 I199F probably damaging Het
Crebbp A T 16: 4,084,063 F2399L possibly damaging Het
Defb36 T C 2: 152,612,579 C53R probably damaging Het
Degs1 T C 1: 182,279,692 M1V probably null Het
Disp2 T A 2: 118,790,338 F517Y probably damaging Het
Dnah5 A G 15: 28,246,319 D601G probably benign Het
Dnpep G A 1: 75,312,538 Q310* probably null Het
Dsg1a A G 18: 20,340,878 T1003A probably benign Het
Fbrsl1 C G 5: 110,396,040 probably benign Het
Foxh1 A T 15: 76,669,254 L116H probably damaging Het
Gigyf2 G A 1: 87,411,875 probably benign Het
Gucy1b1 A G 3: 82,037,911 probably benign Het
Gucy2g T G 19: 55,241,166 D24A probably benign Het
Hirip3 A G 7: 126,863,442 K190R probably damaging Het
Hmmr T C 11: 40,705,954 N717D probably damaging Het
Il12b A T 11: 44,410,218 Y187F probably damaging Het
Iqgap1 A G 7: 80,738,322 I859T probably benign Het
Jmjd1c T C 10: 67,219,326 L175P probably damaging Het
Klc2 T C 19: 5,112,746 M242V possibly damaging Het
Klf3 T C 5: 64,822,103 M96T probably benign Het
Lrrc66 G T 5: 73,607,088 H871N probably benign Het
Ltn1 A T 16: 87,425,640 D168E probably benign Het
Mak T C 13: 41,032,596 D532G probably damaging Het
March6 A G 15: 31,462,005 M859T probably benign Het
Mlxipl C A 5: 135,132,323 N365K probably damaging Het
Mplkip T C 13: 17,695,752 S90P possibly damaging Het
Myo5c A T 9: 75,269,525 H584L probably benign Het
Myt1l A G 12: 29,851,720 T228A possibly damaging Het
Nxpe3 A T 16: 55,866,229 Y139N possibly damaging Het
Olfr1090 T A 2: 86,754,637 I34L probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr568 A G 7: 102,877,140 T7A probably benign Het
Pak6 C T 2: 118,690,332 S268F possibly damaging Het
Parp10 G A 15: 76,243,066 A57V probably damaging Het
Pik3r3 T A 4: 116,256,268 D69E probably damaging Het
Polr2a T G 11: 69,747,425 K105T probably damaging Het
Prdm16 A T 4: 154,328,838 probably benign Het
Prepl G A 17: 85,083,242 T96I probably benign Het
Ret C T 6: 118,165,995 probably benign Het
Rgl3 A T 9: 21,975,812 D541E probably benign Het
Rpa1 A C 11: 75,318,529 Y143D probably benign Het
Rps16 T A 7: 28,351,083 L47Q probably damaging Het
Sbno2 A T 10: 80,068,853 probably null Het
Scube1 A T 15: 83,621,063 N385K probably damaging Het
Shank2 A G 7: 144,031,355 E31G probably damaging Het
Slc38a9 G T 13: 112,729,257 C496F possibly damaging Het
Snap47 A G 11: 59,437,987 V163A probably damaging Het
Sntg2 T C 12: 30,201,261 probably benign Het
Sp7 C A 15: 102,358,460 V322F probably damaging Het
Spic T C 10: 88,676,062 K111E probably damaging Het
Sqor T C 2: 122,798,027 probably benign Het
St6galnac1 T A 11: 116,766,584 M385L probably benign Het
Synpo2 A T 3: 123,079,862 S1211T possibly damaging Het
Sytl2 T A 7: 90,396,589 V638E probably damaging Het
Taar1 T A 10: 23,920,547 S48T probably benign Het
Tbx18 T A 9: 87,729,653 D108V possibly damaging Het
Tdh C T 14: 63,497,593 probably benign Het
Tldc1 T C 8: 119,762,350 D398G possibly damaging Het
Tlr9 T A 9: 106,225,682 L724Q probably benign Het
Tmem270 T A 5: 134,902,788 Y100F probably benign Het
Trim65 G C 11: 116,124,604 probably benign Het
Trrap A T 5: 144,805,750 K1393* probably null Het
Ttc13 A G 8: 124,683,291 V523A probably damaging Het
Utrn T A 10: 12,711,475 D939V probably benign Het
Vmn1r46 G T 6: 89,976,953 M261I probably benign Het
Vwa5a A G 9: 38,737,807 probably null Het
Zfp108 A T 7: 24,260,724 T247S probably benign Het
Zfp366 A T 13: 99,228,621 I97F probably benign Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Gp1ba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Gp1ba APN 11 70640652 unclassified probably benign
IGL00715:Gp1ba APN 11 70639918 unclassified probably benign
R0329:Gp1ba UTSW 11 70640409 unclassified probably benign
R0360:Gp1ba UTSW 11 70640458 unclassified probably benign
R0364:Gp1ba UTSW 11 70640458 unclassified probably benign
R0561:Gp1ba UTSW 11 70639590 unclassified probably benign
R0693:Gp1ba UTSW 11 70640458 unclassified probably benign
R0715:Gp1ba UTSW 11 70640788 unclassified probably benign
R0762:Gp1ba UTSW 11 70641427 missense probably damaging 1.00
R0766:Gp1ba UTSW 11 70641427 missense probably damaging 1.00
R1178:Gp1ba UTSW 11 70641427 missense probably damaging 1.00
R1181:Gp1ba UTSW 11 70641427 missense probably damaging 1.00
R1448:Gp1ba UTSW 11 70641427 missense probably damaging 1.00
R1926:Gp1ba UTSW 11 70640889 unclassified probably benign
R2317:Gp1ba UTSW 11 70640647 unclassified probably benign
R5101:Gp1ba UTSW 11 70641399 missense probably benign 0.13
R6243:Gp1ba UTSW 11 70640137 unclassified probably benign
R7020:Gp1ba UTSW 11 70640313 unclassified probably benign
X0025:Gp1ba UTSW 11 70640902 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGTGCCCACTACTGCCACCTTA -3'
(R):5'- CCAGGTCCAGGTCAGCAACAAGAT -3'

Sequencing Primer
(F):5'- TGCCACCTTAACTACCCCAG -3'
(R):5'- GAAAAGGACTGCTTTCAGAAGTATC -3'
Posted On2013-04-11