Incidental Mutation 'R1940:Zscan10'
ID213970
Institutional Source Beutler Lab
Gene Symbol Zscan10
Ensembl Gene ENSMUSG00000023902
Gene Namezinc finger and SCAN domain containing 10
SynonymsZscan10, Zfp206
MMRRC Submission 039958-MU
Accession Numbers

Ncbi RefSeq: NM_001033425.3; MGI:3040700

Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R1940 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location23600856-23611019 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23609852 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 379 (H379L)
Ref Sequence ENSEMBL: ENSMUSP00000120876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095595] [ENSMUST00000115509] [ENSMUST00000117606] [ENSMUST00000118369] [ENSMUST00000120967] [ENSMUST00000122285] [ENSMUST00000123866] [ENSMUST00000129227] [ENSMUST00000138487] [ENSMUST00000148062]
Predicted Effect probably damaging
Transcript: ENSMUST00000095595
AA Change: H456L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000093255
Gene: ENSMUSG00000023902
AA Change: H456L

DomainStartEndE-ValueType
SCAN 39 145 1.28e-34 SMART
low complexity region 173 194 N/A INTRINSIC
ZnF_C2H2 343 366 4.4e-2 SMART
ZnF_C2H2 378 400 5.59e-4 SMART
ZnF_C2H2 406 428 1.25e-1 SMART
ZnF_C2H2 434 456 2.05e-2 SMART
ZnF_C2H2 478 500 2.75e-3 SMART
low complexity region 507 521 N/A INTRINSIC
ZnF_C2H2 524 547 1.82e-3 SMART
ZnF_C2H2 553 575 3.16e-3 SMART
ZnF_C2H2 581 603 1.95e-3 SMART
ZnF_C2H2 609 631 4.17e-3 SMART
ZnF_C2H2 637 659 1.56e-2 SMART
ZnF_C2H2 665 687 2.4e-3 SMART
ZnF_C2H2 693 715 1.98e-4 SMART
ZnF_C2H2 726 748 1.58e-3 SMART
ZnF_C2H2 754 776 6.42e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115509
AA Change: H346L

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111171
Gene: ENSMUSG00000023902
AA Change: H346L

DomainStartEndE-ValueType
SCAN 39 148 3.37e-34 SMART
ZnF_C2H2 233 256 4.4e-2 SMART
ZnF_C2H2 268 290 5.59e-4 SMART
ZnF_C2H2 296 318 1.25e-1 SMART
ZnF_C2H2 324 346 2.05e-2 SMART
ZnF_C2H2 368 390 2.75e-3 SMART
low complexity region 397 411 N/A INTRINSIC
ZnF_C2H2 414 437 1.82e-3 SMART
ZnF_C2H2 443 465 3.16e-3 SMART
ZnF_C2H2 471 493 1.95e-3 SMART
ZnF_C2H2 499 521 4.17e-3 SMART
ZnF_C2H2 527 549 1.56e-2 SMART
ZnF_C2H2 555 577 2.4e-3 SMART
ZnF_C2H2 583 605 1.98e-4 SMART
ZnF_C2H2 616 638 1.58e-3 SMART
ZnF_C2H2 644 666 6.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117606
SMART Domains Protein: ENSMUSP00000112460
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 147 1.73e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118369
SMART Domains Protein: ENSMUSP00000113757
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 152 1.59e-30 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120967
AA Change: H424L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113386
Gene: ENSMUSG00000023902
AA Change: H424L

DomainStartEndE-ValueType
SCAN 39 145 1.28e-34 SMART
low complexity region 173 194 N/A INTRINSIC
ZnF_C2H2 346 368 5.59e-4 SMART
ZnF_C2H2 374 396 1.25e-1 SMART
ZnF_C2H2 402 424 2.05e-2 SMART
ZnF_C2H2 446 468 2.75e-3 SMART
low complexity region 475 489 N/A INTRINSIC
ZnF_C2H2 492 515 1.82e-3 SMART
ZnF_C2H2 521 543 3.16e-3 SMART
ZnF_C2H2 549 571 1.95e-3 SMART
ZnF_C2H2 577 599 4.17e-3 SMART
ZnF_C2H2 605 627 1.56e-2 SMART
ZnF_C2H2 633 655 2.4e-3 SMART
ZnF_C2H2 661 683 1.98e-4 SMART
ZnF_C2H2 694 716 1.58e-3 SMART
ZnF_C2H2 722 744 6.42e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122285
SMART Domains Protein: ENSMUSP00000112559
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 152 1.59e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123866
SMART Domains Protein: ENSMUSP00000116748
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 148 2.38e-34 SMART
ZnF_C2H2 267 290 4.4e-2 SMART
ZnF_C2H2 302 324 5.59e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125912
Predicted Effect probably damaging
Transcript: ENSMUST00000129227
AA Change: H220L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000118987
Gene: ENSMUSG00000023902
AA Change: H220L

DomainStartEndE-ValueType
ZnF_C2H2 142 164 5.59e-4 SMART
ZnF_C2H2 170 192 1.25e-1 SMART
ZnF_C2H2 198 220 2.05e-2 SMART
ZnF_C2H2 242 264 2.75e-3 SMART
low complexity region 271 285 N/A INTRINSIC
ZnF_C2H2 288 311 1.82e-3 SMART
ZnF_C2H2 317 339 3.16e-3 SMART
ZnF_C2H2 345 367 1.95e-3 SMART
ZnF_C2H2 373 395 4.17e-3 SMART
ZnF_C2H2 401 423 1.56e-2 SMART
ZnF_C2H2 429 451 2.4e-3 SMART
ZnF_C2H2 457 479 1.98e-4 SMART
ZnF_C2H2 490 512 1.58e-3 SMART
ZnF_C2H2 518 540 6.42e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133749
Predicted Effect probably benign
Transcript: ENSMUST00000138487
SMART Domains Protein: ENSMUSP00000114341
Gene: ENSMUSG00000023902

DomainStartEndE-ValueType
SCAN 39 148 3.37e-34 SMART
ZnF_C2H2 236 258 5.59e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148062
AA Change: H379L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120876
Gene: ENSMUSG00000023902
AA Change: H379L

DomainStartEndE-ValueType
Pfam:SCAN 37 88 7.5e-20 PFAM
low complexity region 128 149 N/A INTRINSIC
ZnF_C2H2 301 323 5.59e-4 SMART
ZnF_C2H2 329 351 1.25e-1 SMART
ZnF_C2H2 357 379 2.05e-2 SMART
ZnF_C2H2 401 423 2.75e-3 SMART
low complexity region 430 444 N/A INTRINSIC
ZnF_C2H2 447 470 1.82e-3 SMART
ZnF_C2H2 476 498 3.16e-3 SMART
ZnF_C2H2 504 526 1.95e-3 SMART
ZnF_C2H2 532 554 4.17e-3 SMART
ZnF_C2H2 560 582 1.56e-2 SMART
ZnF_C2H2 588 610 2.4e-3 SMART
ZnF_C2H2 616 638 1.98e-4 SMART
ZnF_C2H2 649 671 1.58e-3 SMART
ZnF_C2H2 677 699 6.42e-4 SMART
Meta Mutation Damage Score 0.306 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.8%
  • 20x: 93.7%
Validation Efficiency 98% (108/110)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele exhibit a pleiotropic phenotype including reduced weight, mild hypoplasia in the spleen, heart and long bones, eye malformations including microphthalmia, altered platelet counts, an activated immune status, and behavioral alterations. [provided by MGI curators]
Allele List at MGI

All alleles(357) : Targeted(5) Gene trapped(352)

Other mutations in this stock
Total: 107 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T A 15: 8,233,852 S2496R probably damaging Het
Abca16 T C 7: 120,433,609 probably benign Het
Ace2 A T X: 164,156,528 M123L possibly damaging Het
Acvr1c A T 2: 58,283,505 N248K probably damaging Het
Adam24 A T 8: 40,681,361 R623* probably null Het
Agbl2 T A 2: 90,811,282 L752Q probably damaging Het
Ankrd26 A T 6: 118,511,693 F1335Y probably damaging Het
Ankrd34a A G 3: 96,598,676 S399G probably benign Het
Ap3d1 G A 10: 80,709,773 P1041S probably benign Het
Arid3b A T 9: 57,796,148 M466K possibly damaging Het
Arsj T C 3: 126,438,346 I247T probably damaging Het
AU016765 G A 17: 64,519,878 noncoding transcript Het
Azin2 C T 4: 128,950,784 probably null Het
Bcat2 T C 7: 45,588,368 Y313H possibly damaging Het
Cables2 A G 2: 180,260,080 V465A probably damaging Het
Ccdc60 G A 5: 116,126,165 H517Y probably damaging Het
Cd55b A T 1: 130,418,106 probably null Het
Cdc40 G A 10: 40,883,071 probably benign Het
Cdh7 G A 1: 110,049,024 V140I probably benign Het
Cfi T C 3: 129,858,828 probably benign Het
Chit1 G A 1: 134,145,418 probably null Het
Chn1 A G 2: 73,624,901 C39R probably damaging Het
Ciao1 A G 2: 127,246,460 S148P possibly damaging Het
Clmn G A 12: 104,790,102 T163I probably damaging Het
Cngb1 C A 8: 95,299,692 G154W probably damaging Het
Col19a1 A T 1: 24,264,750 C1117* probably null Het
Cyp2d10 T A 15: 82,405,294 I206F probably benign Het
Ddrgk1 G T 2: 130,663,560 probably benign Het
Ddx18 A T 1: 121,555,224 V611D probably damaging Het
Dnah8 A T 17: 30,731,207 H2000L probably damaging Het
Duox1 T C 2: 122,325,984 V464A probably benign Het
Dync2h1 A G 9: 7,139,159 probably null Het
Eif4enif1 A G 11: 3,243,279 H857R probably damaging Het
Elmo2 A G 2: 165,292,050 probably benign Het
Fam171b CCAGCAGCAGCAGCAGCAGCAGC CCAGCAGCAGCAGCAGCAGC 2: 83,812,874 probably benign Het
Glrx A G 13: 75,840,137 I57V probably benign Het
Gm281 A T 14: 13,828,582 M726K probably null Het
Golm1 A T 13: 59,642,237 probably benign Het
Grm3 G A 5: 9,511,682 R723W probably damaging Het
Gsta3 G A 1: 21,257,377 R45Q probably benign Het
Gtf3c3 A C 1: 54,428,958 probably benign Het
Hk3 C T 13: 55,011,391 V451I probably damaging Het
Hoxa10 C A 6: 52,234,370 G189C possibly damaging Het
Hs3st3b1 T C 11: 63,889,743 D186G probably benign Het
Hscb G T 5: 110,836,060 H63N probably benign Het
Itpr3 A G 17: 27,111,217 E1603G probably damaging Het
Ivl T A 3: 92,572,749 H3L probably benign Het
Klhl26 C A 8: 70,452,261 R252L probably damaging Het
Krt31 T A 11: 100,048,243 T251S probably benign Het
Lama5 T C 2: 180,190,921 N1646S probably benign Het
Lhx3 T C 2: 26,203,962 D83G probably benign Het
Lss C A 10: 76,545,462 N427K possibly damaging Het
Mettl24 G A 10: 40,737,726 A154T probably benign Het
Mgat4a A T 1: 37,536,037 probably null Het
Moxd2 C T 6: 40,883,532 R326Q probably damaging Het
Mpdz G A 4: 81,361,443 A669V probably benign Het
Msra G A 14: 64,285,056 probably benign Het
Muc13 A T 16: 33,807,911 T344S probably benign Het
Myo3b T C 2: 70,258,075 I866T probably benign Het
Nbea T C 3: 55,953,100 S1852G possibly damaging Het
Ncf2 A G 1: 152,834,064 probably benign Het
Nfyc C A 4: 120,773,664 probably benign Het
Nop2 T C 6: 125,134,634 V110A probably benign Het
Nrg2 C A 18: 36,196,844 probably benign Het
Nrl A G 14: 55,522,435 Y12H probably damaging Het
Nrxn3 T C 12: 89,260,381 V635A probably damaging Het
Olfr1014 T A 2: 85,777,171 S196T probably benign Het
Olfr1415 T A 1: 92,491,735 T7S probably benign Het
Olfr1423 A C 19: 12,035,911 V277G probably benign Het
Olfr228 T A 2: 86,483,359 K128* probably null Het
Papolg A T 11: 23,867,279 N639K probably benign Het
Paqr4 T C 17: 23,737,664 I242V probably damaging Het
Pramel6 A T 2: 87,508,732 K92M probably damaging Het
Prg4 T C 1: 150,456,023 T300A possibly damaging Het
Ptprb A T 10: 116,319,610 probably benign Het
Rab28 A T 5: 41,625,790 S216T probably benign Het
Rrp1b A T 17: 32,056,845 R455S possibly damaging Het
Sash1 A T 10: 8,729,932 M898K probably benign Het
Scn8a C T 15: 100,970,204 T310I probably benign Het
Secisbp2l C A 2: 125,740,339 D1066Y probably damaging Het
Sipa1l2 A G 8: 125,480,148 probably benign Het
Slc12a1 A G 2: 125,194,193 T662A probably benign Het
Slc12a4 T C 8: 105,946,037 I749V probably benign Het
Slc22a27 A G 19: 7,909,727 S266P probably damaging Het
Slc25a14 G A X: 48,651,963 V210I probably benign Het
Slit1 T A 19: 41,630,776 N762I probably damaging Het
Spata31d1b C A 13: 59,718,021 D994E possibly damaging Het
Sphk1 A G 11: 116,535,850 I204V probably benign Het
Srsf6 C T 2: 162,934,483 probably benign Het
Svs1 A T 6: 48,990,073 K652* probably null Het
Tet2 T C 3: 133,488,638 T12A possibly damaging Het
Tgfbi A T 13: 56,614,314 Q70L possibly damaging Het
Tlr9 T C 9: 106,224,647 L379P probably damaging Het
Tnrc6c A G 11: 117,756,023 D1450G possibly damaging Het
Tra2b A G 16: 22,255,045 probably benign Het
Trit1 T C 4: 123,054,240 I451T probably benign Het
Trnau1ap A G 4: 132,321,803 Y30H probably damaging Het
Ttc34 G A 4: 154,865,682 A1031T possibly damaging Het
Ubiad1 A G 4: 148,444,011 L147P probably damaging Het
Ush2a A G 1: 188,951,561 D4979G probably null Het
Usp50 C T 2: 126,778,023 R123Q probably benign Het
Vmn2r117 A T 17: 23,477,480 Y318N probably damaging Het
Whamm C T 7: 81,578,299 T304I probably null Het
Wipf2 C T 11: 98,892,410 R221* probably null Het
Ythdf3 A G 3: 16,205,092 N468D possibly damaging Het
Zbtb17 T C 4: 141,465,548 I486T possibly damaging Het
Zfp3 T C 11: 70,771,376 S54P probably benign Het
Other mutations in Zscan10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00572:Zscan10 APN 17 23609461 missense probably damaging 0.98
IGL01353:Zscan10 APN 17 23609600 missense probably damaging 1.00
IGL02327:Zscan10 APN 17 23607572 splice site probably benign
IGL02556:Zscan10 APN 17 23608145 missense possibly damaging 0.90
FR4737:Zscan10 UTSW 17 23609445 small deletion probably benign
P0043:Zscan10 UTSW 17 23609620 nonsense probably null
R0345:Zscan10 UTSW 17 23610082 missense probably damaging 1.00
R0401:Zscan10 UTSW 17 23605915 missense probably damaging 1.00
R0699:Zscan10 UTSW 17 23608118 missense probably damaging 1.00
R0838:Zscan10 UTSW 17 23610034 missense possibly damaging 0.83
R0919:Zscan10 UTSW 17 23610007 missense probably damaging 0.99
R4647:Zscan10 UTSW 17 23610340 missense probably benign
R4753:Zscan10 UTSW 17 23607234 missense probably damaging 0.99
R4971:Zscan10 UTSW 17 23607173 missense possibly damaging 0.67
R5110:Zscan10 UTSW 17 23609632 missense probably damaging 1.00
R5410:Zscan10 UTSW 17 23610421 missense probably damaging 1.00
R5516:Zscan10 UTSW 17 23609359 missense possibly damaging 0.66
R5871:Zscan10 UTSW 17 23607267 intron probably benign
R6109:Zscan10 UTSW 17 23607129 missense probably damaging 0.98
R6626:Zscan10 UTSW 17 23605857 missense probably damaging 1.00
R6750:Zscan10 UTSW 17 23607190 missense possibly damaging 0.49
R6846:Zscan10 UTSW 17 23605607 missense probably damaging 0.97
R7184:Zscan10 UTSW 17 23607029 intron probably null
R7223:Zscan10 UTSW 17 23609482 missense probably benign 0.00
R7436:Zscan10 UTSW 17 23610005 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GATCCTCAAGCTGCACATGC -3'
(R):5'- ACACACATAGGGGTTACTCTCC -3'

Sequencing Primer
(F):5'- AGCTGCACATGCGCACTC -3'
(R):5'- TACTCTCCTGGCTAGAGCTAAGG -3'
Posted On2014-07-14