Incidental Mutation 'R0126:Sntg2'
ID21399
Institutional Source Beutler Lab
Gene Symbol Sntg2
Ensembl Gene ENSMUSG00000020672
Gene Namesyntrophin, gamma 2
Synonyms2210008K22Rik
MMRRC Submission 038411-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R0126 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location30174482-30373375 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 30201261 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021004] [ENSMUST00000133324] [ENSMUST00000142046] [ENSMUST00000149710]
Predicted Effect probably benign
Transcript: ENSMUST00000021004
SMART Domains Protein: ENSMUSP00000021004
Gene: ENSMUSG00000020672

DomainStartEndE-ValueType
PDZ 82 156 1.83e-17 SMART
low complexity region 159 183 N/A INTRINSIC
PH 297 423 7.66e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130062
Predicted Effect probably benign
Transcript: ENSMUST00000133324
SMART Domains Protein: ENSMUSP00000114245
Gene: ENSMUSG00000020672

DomainStartEndE-ValueType
Blast:PH 13 70 9e-24 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000142046
SMART Domains Protein: ENSMUSP00000115942
Gene: ENSMUSG00000020672

DomainStartEndE-ValueType
Blast:PH 13 89 1e-23 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149710
SMART Domains Protein: ENSMUSP00000123332
Gene: ENSMUSG00000020672

DomainStartEndE-ValueType
PDZ 82 156 1.83e-17 SMART
low complexity region 159 183 N/A INTRINSIC
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.2%
  • 20x: 81.8%
Validation Efficiency 98% (102/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the syntrophin family. Syntrophins are cytoplasmic peripheral membrane proteins that bind to components of mechanosenstive sodium channels and the extreme carboxy-terminal domain of dystrophin and dystrophin-related proteins. The PDZ domain of this protein product interacts with a protein component of a mechanosensitive sodium channel that affects channel gating. Absence or reduction of this protein product has been associated with Duchenne muscular dystrophy. There is evidence of alternative splicing yet the full-length nature of these variants has not been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,443,730 L1730P possibly damaging Het
Adam9 T C 8: 24,970,737 N577S probably damaging Het
Add1 T C 5: 34,613,579 Y316H probably benign Het
Agpat3 T C 10: 78,278,056 D266G probably null Het
Aldh3a2 C A 11: 61,224,558 Q524H probably benign Het
Alox12b A C 11: 69,167,471 S550R probably benign Het
Ano4 T A 10: 88,952,292 I753F possibly damaging Het
AW011738 T A 4: 156,203,647 probably benign Het
B4galt3 C T 1: 171,276,165 T103M probably damaging Het
Cabs1 C T 5: 87,980,195 T235I probably damaging Het
Casc4 T C 2: 121,906,084 probably benign Het
Casq2 A G 3: 102,133,399 H272R probably damaging Het
Ccdc180 T C 4: 45,912,866 probably null Het
Cdh12 A T 15: 21,583,945 M624L probably benign Het
Cdh5 A C 8: 104,140,682 probably null Het
Col7a1 A G 9: 108,969,583 probably benign Het
Cpne2 A T 8: 94,554,933 I199F probably damaging Het
Crebbp A T 16: 4,084,063 F2399L possibly damaging Het
Defb36 T C 2: 152,612,579 C53R probably damaging Het
Degs1 T C 1: 182,279,692 M1V probably null Het
Disp2 T A 2: 118,790,338 F517Y probably damaging Het
Dnah5 A G 15: 28,246,319 D601G probably benign Het
Dnpep G A 1: 75,312,538 Q310* probably null Het
Dsg1a A G 18: 20,340,878 T1003A probably benign Het
Fbrsl1 C G 5: 110,396,040 probably benign Het
Foxh1 A T 15: 76,669,254 L116H probably damaging Het
Gigyf2 G A 1: 87,411,875 probably benign Het
Gp1ba A T 11: 70,641,033 probably benign Het
Gucy1b1 A G 3: 82,037,911 probably benign Het
Gucy2g T G 19: 55,241,166 D24A probably benign Het
Hirip3 A G 7: 126,863,442 K190R probably damaging Het
Hmmr T C 11: 40,705,954 N717D probably damaging Het
Il12b A T 11: 44,410,218 Y187F probably damaging Het
Iqgap1 A G 7: 80,738,322 I859T probably benign Het
Jmjd1c T C 10: 67,219,326 L175P probably damaging Het
Klc2 T C 19: 5,112,746 M242V possibly damaging Het
Klf3 T C 5: 64,822,103 M96T probably benign Het
Lrrc66 G T 5: 73,607,088 H871N probably benign Het
Ltn1 A T 16: 87,425,640 D168E probably benign Het
Mak T C 13: 41,032,596 D532G probably damaging Het
March6 A G 15: 31,462,005 M859T probably benign Het
Mlxipl C A 5: 135,132,323 N365K probably damaging Het
Mplkip T C 13: 17,695,752 S90P possibly damaging Het
Myo5c A T 9: 75,269,525 H584L probably benign Het
Myt1l A G 12: 29,851,720 T228A possibly damaging Het
Nxpe3 A T 16: 55,866,229 Y139N possibly damaging Het
Olfr1090 T A 2: 86,754,637 I34L probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr568 A G 7: 102,877,140 T7A probably benign Het
Pak6 C T 2: 118,690,332 S268F possibly damaging Het
Parp10 G A 15: 76,243,066 A57V probably damaging Het
Pik3r3 T A 4: 116,256,268 D69E probably damaging Het
Polr2a T G 11: 69,747,425 K105T probably damaging Het
Prdm16 A T 4: 154,328,838 probably benign Het
Prepl G A 17: 85,083,242 T96I probably benign Het
Ret C T 6: 118,165,995 probably benign Het
Rgl3 A T 9: 21,975,812 D541E probably benign Het
Rpa1 A C 11: 75,318,529 Y143D probably benign Het
Rps16 T A 7: 28,351,083 L47Q probably damaging Het
Sbno2 A T 10: 80,068,853 probably null Het
Scube1 A T 15: 83,621,063 N385K probably damaging Het
Shank2 A G 7: 144,031,355 E31G probably damaging Het
Slc38a9 G T 13: 112,729,257 C496F possibly damaging Het
Snap47 A G 11: 59,437,987 V163A probably damaging Het
Sp7 C A 15: 102,358,460 V322F probably damaging Het
Spic T C 10: 88,676,062 K111E probably damaging Het
Sqor T C 2: 122,798,027 probably benign Het
St6galnac1 T A 11: 116,766,584 M385L probably benign Het
Synpo2 A T 3: 123,079,862 S1211T possibly damaging Het
Sytl2 T A 7: 90,396,589 V638E probably damaging Het
Taar1 T A 10: 23,920,547 S48T probably benign Het
Tbx18 T A 9: 87,729,653 D108V possibly damaging Het
Tdh C T 14: 63,497,593 probably benign Het
Tldc1 T C 8: 119,762,350 D398G possibly damaging Het
Tlr9 T A 9: 106,225,682 L724Q probably benign Het
Tmem270 T A 5: 134,902,788 Y100F probably benign Het
Trim65 G C 11: 116,124,604 probably benign Het
Trrap A T 5: 144,805,750 K1393* probably null Het
Ttc13 A G 8: 124,683,291 V523A probably damaging Het
Utrn T A 10: 12,711,475 D939V probably benign Het
Vmn1r46 G T 6: 89,976,953 M261I probably benign Het
Vwa5a A G 9: 38,737,807 probably null Het
Zfp108 A T 7: 24,260,724 T247S probably benign Het
Zfp366 A T 13: 99,228,621 I97F probably benign Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Sntg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00231:Sntg2 APN 12 30276721 missense probably benign 0.08
IGL00914:Sntg2 APN 12 30257957 intron probably benign
IGL00950:Sntg2 APN 12 30312681 splice site probably benign
IGL01106:Sntg2 APN 12 30257988 nonsense probably null
IGL01732:Sntg2 APN 12 30312649 missense probably damaging 0.99
IGL01987:Sntg2 APN 12 30312570 missense probably damaging 1.00
IGL02138:Sntg2 APN 12 30307231 critical splice acceptor site probably null
IGL02325:Sntg2 APN 12 30195543 missense probably benign 0.08
IGL02619:Sntg2 APN 12 30267026 splice site probably null
IGL02797:Sntg2 APN 12 30226892 missense possibly damaging 0.93
IGL03176:Sntg2 APN 12 30267023 splice site probably benign
PIT4445001:Sntg2 UTSW 12 30312572 missense probably damaging 1.00
R0309:Sntg2 UTSW 12 30226773 missense probably benign 0.03
R0614:Sntg2 UTSW 12 30257978 missense possibly damaging 0.87
R1267:Sntg2 UTSW 12 30245128 missense probably benign 0.42
R1546:Sntg2 UTSW 12 30288296 missense probably damaging 1.00
R1696:Sntg2 UTSW 12 30267063 missense probably damaging 1.00
R1708:Sntg2 UTSW 12 30373180 missense possibly damaging 0.81
R1867:Sntg2 UTSW 12 30236651 missense probably benign
R2256:Sntg2 UTSW 12 30236688 nonsense probably null
R2895:Sntg2 UTSW 12 30226846 missense probably benign 0.00
R3401:Sntg2 UTSW 12 30288172 splice site probably benign
R3522:Sntg2 UTSW 12 30312567 missense probably damaging 0.99
R4771:Sntg2 UTSW 12 30276659 splice site probably null
R4814:Sntg2 UTSW 12 30373268 unclassified probably benign
R5554:Sntg2 UTSW 12 30258041 missense probably benign 0.08
R6056:Sntg2 UTSW 12 30312561 missense probably benign 0.06
R6328:Sntg2 UTSW 12 30258014 missense probably damaging 1.00
R6373:Sntg2 UTSW 12 30258041 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TCTGAATCATAGCTGCCAAGCACC -3'
(R):5'- AGCAAGGAAGATCCCAGTGCCTAC -3'

Sequencing Primer
(F):5'- AGCACCATTTCACTGGACATTTTG -3'
(R):5'- GACTGAAAACAGTGTCCTTTGGC -3'
Posted On2013-04-11