Incidental Mutation 'R1941:Supv3l1'
ID214019
Institutional Source Beutler Lab
Gene Symbol Supv3l1
Ensembl Gene ENSMUSG00000020079
Gene Namesuppressor of var1, 3-like 1 (S. cerevisiae)
Synonyms
MMRRC Submission 039959-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1941 (G1)
Quality Score87
Status Not validated
Chromosome10
Chromosomal Location62429209-62449738 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 62449612 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 25 (P25R)
Ref Sequence ENSEMBL: ENSMUSP00000020273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020273] [ENSMUST00000181110]
Predicted Effect probably benign
Transcript: ENSMUST00000020273
AA Change: P25R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000020273
Gene: ENSMUSG00000020079
AA Change: P25R

DomainStartEndE-ValueType
low complexity region 8 25 N/A INTRINSIC
low complexity region 47 56 N/A INTRINSIC
HELICc 379 475 1.44e-18 SMART
Pfam:SUV3_C 625 672 4e-19 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000162023
AA Change: P24R
Predicted Effect unknown
Transcript: ENSMUST00000181110
AA Change: K38N
SMART Domains Protein: ENSMUSP00000137990
Gene: ENSMUSG00000097129
AA Change: K38N

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 39 53 N/A INTRINSIC
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a hypomorphic allele exhibit embryonic lethality between E9.5 and E12.5. Mice homozygous for a knock-out allele exhibit embryonic lethality between E8.5 and 9.5. Mice heterozygous for this allele produce offspring with mitochondrial defects regardless of offspring genotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Art2b A C 7: 101,580,317 F125C probably damaging Het
BC027072 T G 17: 71,752,068 T205P probably damaging Het
Camta1 T C 4: 151,075,155 Y1616C probably damaging Het
Cep162 T G 9: 87,199,995 I1286L probably benign Het
Chd9 T A 8: 90,977,069 probably null Het
Col11a2 T A 17: 34,044,951 S247T probably benign Het
Col6a4 T G 9: 106,075,010 D563A probably benign Het
Crebbp C T 16: 4,179,691 M176I probably benign Het
Cyp4a12b A G 4: 115,438,059 N454S probably damaging Het
Dhx8 T C 11: 101,752,198 probably null Het
Dock7 G A 4: 98,984,715 L1165F probably benign Het
Fam117a A T 11: 95,380,798 N399Y probably damaging Het
Fmn1 A G 2: 113,365,143 K396R unknown Het
Foxk1 T A 5: 142,456,674 V693E possibly damaging Het
Gml A G 15: 74,817,171 L10P probably damaging Het
Gpx8 A G 13: 113,046,275 L34P probably damaging Het
Kank2 A G 9: 21,772,866 L689P possibly damaging Het
Mt4 G A 8: 94,138,246 C16Y possibly damaging Het
Naa15 C A 3: 51,455,934 Y346* probably null Het
Ntrk3 C T 7: 78,247,262 V676I probably damaging Het
Oasl2 G A 5: 114,911,362 probably benign Het
Olfr376 T A 11: 73,375,621 F294I probably damaging Het
Olfr767 T G 10: 129,079,954 N3T probably damaging Het
Olfr811 T A 10: 129,802,412 M38L probably benign Het
Olfr835 A C 9: 19,035,866 T248P possibly damaging Het
Olfr860 G A 9: 19,845,950 S223F probably damaging Het
Otud7a C T 7: 63,729,826 R273* probably null Het
Pde11a C T 2: 76,291,250 R329Q probably benign Het
Pga5 G T 19: 10,669,456 probably null Het
Ppp1r1a A G 15: 103,533,101 probably null Het
Pus10 A G 11: 23,711,198 Q262R possibly damaging Het
Rbm17 T C 2: 11,589,074 K241R possibly damaging Het
Rp1l1 T G 14: 64,022,252 D114E probably damaging Het
Safb T A 17: 56,598,992 probably benign Het
Sgpl1 T C 10: 61,103,307 Y371C probably damaging Het
Siglec1 C A 2: 131,078,131 A827S possibly damaging Het
Smg5 T A 3: 88,345,380 S158T possibly damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spaca6 A G 17: 17,838,402 I71V probably benign Het
Spaca6 A G 17: 17,838,430 E80G probably damaging Het
Steap1 C A 5: 5,740,541 A136S probably damaging Het
Tex21 T C 12: 76,221,684 K108R possibly damaging Het
Tnc A G 4: 64,014,964 Y688H probably damaging Het
Tnr G A 1: 159,850,134 E30K possibly damaging Het
Tnrc18 G T 5: 142,815,150 P18T probably damaging Het
Ttk T G 9: 83,853,126 S422A probably benign Het
Ubap1 A G 4: 41,378,968 K61E probably damaging Het
Ubr2 C T 17: 46,974,026 R522H probably damaging Het
Vwf A T 6: 125,639,279 E1185D possibly damaging Het
Wwp2 A G 8: 107,517,915 T194A probably benign Het
Zfp36 A G 7: 28,377,646 V279A probably damaging Het
Zfp870 C A 17: 32,882,804 R517L possibly damaging Het
Other mutations in Supv3l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03067:Supv3l1 APN 10 62429821 missense probably damaging 1.00
R0090:Supv3l1 UTSW 10 62429706 missense probably benign 0.00
R0477:Supv3l1 UTSW 10 62430585 missense probably damaging 0.98
R0946:Supv3l1 UTSW 10 62429820 missense probably damaging 1.00
R1460:Supv3l1 UTSW 10 62443383 splice site probably benign
R1546:Supv3l1 UTSW 10 62432446 missense probably benign 0.08
R3916:Supv3l1 UTSW 10 62449420 missense possibly damaging 0.67
R5030:Supv3l1 UTSW 10 62430615 missense probably damaging 1.00
R5040:Supv3l1 UTSW 10 62447065 missense possibly damaging 0.93
R5051:Supv3l1 UTSW 10 62443417 missense probably damaging 0.99
R5085:Supv3l1 UTSW 10 62435512 missense probably benign 0.00
R5288:Supv3l1 UTSW 10 62430596 missense possibly damaging 0.90
R5359:Supv3l1 UTSW 10 62432399 missense probably damaging 0.96
R5372:Supv3l1 UTSW 10 62432357 missense probably damaging 0.99
R5384:Supv3l1 UTSW 10 62430596 missense possibly damaging 0.90
R5385:Supv3l1 UTSW 10 62430596 missense possibly damaging 0.90
R5527:Supv3l1 UTSW 10 62429829 missense probably damaging 1.00
R5602:Supv3l1 UTSW 10 62430592 missense possibly damaging 0.81
R5713:Supv3l1 UTSW 10 62430504 missense possibly damaging 0.91
R6150:Supv3l1 UTSW 10 62435722 missense possibly damaging 0.90
R6220:Supv3l1 UTSW 10 62439021 missense possibly damaging 0.82
R6903:Supv3l1 UTSW 10 62441237 missense probably damaging 1.00
R6941:Supv3l1 UTSW 10 62430586 missense possibly damaging 0.86
R7187:Supv3l1 UTSW 10 62435549 missense probably damaging 1.00
R7250:Supv3l1 UTSW 10 62445067 missense probably damaging 1.00
R7438:Supv3l1 UTSW 10 62430470 critical splice donor site probably null
R7439:Supv3l1 UTSW 10 62430615 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTTGTCTAGAGGCCGAGTGAG -3'
(R):5'- AACGTACAGAGGTCGTGCTC -3'

Sequencing Primer
(F):5'- AGGCCGAGTGAGCTCCG -3'
(R):5'- TTCCTTCAGGCGCACGC -3'
Posted On2014-07-14