Incidental Mutation 'R1941:Olfr811'
ID214021
Institutional Source Beutler Lab
Gene Symbol Olfr811
Ensembl Gene ENSMUSG00000063173
Gene Nameolfactory receptor 811
SynonymsMOR110-6, GA_x6K02T2PULF-11481207-11480248
MMRRC Submission 039959-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R1941 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location129800615-129804396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 129802412 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 38 (M38L)
Ref Sequence ENSEMBL: ENSMUSP00000149970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076437] [ENSMUST00000215058] [ENSMUST00000217571]
Predicted Effect probably benign
Transcript: ENSMUST00000076437
AA Change: M38L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000075768
Gene: ENSMUSG00000063173
AA Change: M38L

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 1.1e-51 PFAM
Pfam:7tm_1 39 288 1.5e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215058
AA Change: M38L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216283
Predicted Effect probably benign
Transcript: ENSMUST00000217571
AA Change: M38L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Art2b A C 7: 101,580,317 F125C probably damaging Het
BC027072 T G 17: 71,752,068 T205P probably damaging Het
Camta1 T C 4: 151,075,155 Y1616C probably damaging Het
Cep162 T G 9: 87,199,995 I1286L probably benign Het
Chd9 T A 8: 90,977,069 probably null Het
Col11a2 T A 17: 34,044,951 S247T probably benign Het
Col6a4 T G 9: 106,075,010 D563A probably benign Het
Crebbp C T 16: 4,179,691 M176I probably benign Het
Cyp4a12b A G 4: 115,438,059 N454S probably damaging Het
Dhx8 T C 11: 101,752,198 probably null Het
Dock7 G A 4: 98,984,715 L1165F probably benign Het
Fam117a A T 11: 95,380,798 N399Y probably damaging Het
Fmn1 A G 2: 113,365,143 K396R unknown Het
Foxk1 T A 5: 142,456,674 V693E possibly damaging Het
Gml A G 15: 74,817,171 L10P probably damaging Het
Gpx8 A G 13: 113,046,275 L34P probably damaging Het
Kank2 A G 9: 21,772,866 L689P possibly damaging Het
Mt4 G A 8: 94,138,246 C16Y possibly damaging Het
Naa15 C A 3: 51,455,934 Y346* probably null Het
Ntrk3 C T 7: 78,247,262 V676I probably damaging Het
Oasl2 G A 5: 114,911,362 probably benign Het
Olfr376 T A 11: 73,375,621 F294I probably damaging Het
Olfr767 T G 10: 129,079,954 N3T probably damaging Het
Olfr835 A C 9: 19,035,866 T248P possibly damaging Het
Olfr860 G A 9: 19,845,950 S223F probably damaging Het
Otud7a C T 7: 63,729,826 R273* probably null Het
Pde11a C T 2: 76,291,250 R329Q probably benign Het
Pga5 G T 19: 10,669,456 probably null Het
Ppp1r1a A G 15: 103,533,101 probably null Het
Pus10 A G 11: 23,711,198 Q262R possibly damaging Het
Rbm17 T C 2: 11,589,074 K241R possibly damaging Het
Rp1l1 T G 14: 64,022,252 D114E probably damaging Het
Safb T A 17: 56,598,992 probably benign Het
Sgpl1 T C 10: 61,103,307 Y371C probably damaging Het
Siglec1 C A 2: 131,078,131 A827S possibly damaging Het
Smg5 T A 3: 88,345,380 S158T possibly damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spaca6 A G 17: 17,838,402 I71V probably benign Het
Spaca6 A G 17: 17,838,430 E80G probably damaging Het
Steap1 C A 5: 5,740,541 A136S probably damaging Het
Supv3l1 G C 10: 62,449,612 P25R probably benign Het
Tex21 T C 12: 76,221,684 K108R possibly damaging Het
Tnc A G 4: 64,014,964 Y688H probably damaging Het
Tnr G A 1: 159,850,134 E30K possibly damaging Het
Tnrc18 G T 5: 142,815,150 P18T probably damaging Het
Ttk T G 9: 83,853,126 S422A probably benign Het
Ubap1 A G 4: 41,378,968 K61E probably damaging Het
Ubr2 C T 17: 46,974,026 R522H probably damaging Het
Vwf A T 6: 125,639,279 E1185D possibly damaging Het
Wwp2 A G 8: 107,517,915 T194A probably benign Het
Zfp36 A G 7: 28,377,646 V279A probably damaging Het
Zfp870 C A 17: 32,882,804 R517L possibly damaging Het
Other mutations in Olfr811
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00945:Olfr811 APN 10 129801907 missense possibly damaging 0.64
IGL01957:Olfr811 APN 10 129802250 missense probably damaging 1.00
IGL02394:Olfr811 APN 10 129802313 missense possibly damaging 0.90
IGL02451:Olfr811 APN 10 129801833 nonsense probably null
IGL03111:Olfr811 APN 10 129802078 missense probably benign 0.00
IGL03369:Olfr811 APN 10 129802471 missense probably damaging 0.99
R0704:Olfr811 UTSW 10 129802303 missense probably benign 0.01
R1393:Olfr811 UTSW 10 129801932 missense probably benign 0.22
R1994:Olfr811 UTSW 10 129801661 missense probably damaging 1.00
R3427:Olfr811 UTSW 10 129801851 missense possibly damaging 0.85
R4296:Olfr811 UTSW 10 129802300 missense probably damaging 0.97
R4937:Olfr811 UTSW 10 129802063 missense probably benign 0.31
R5016:Olfr811 UTSW 10 129801793 missense probably benign 0.01
R5615:Olfr811 UTSW 10 129801767 missense probably damaging 1.00
R5662:Olfr811 UTSW 10 129802307 missense possibly damaging 0.83
R5750:Olfr811 UTSW 10 129801620 missense probably benign 0.01
R6109:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6109:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6110:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6110:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6117:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6117:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6119:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6119:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6120:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6120:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6124:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6124:Olfr811 UTSW 10 129801821 missense probably damaging 1.00
R6395:Olfr811 UTSW 10 129802144 missense probably damaging 1.00
R6440:Olfr811 UTSW 10 129801968 missense probably damaging 1.00
R6559:Olfr811 UTSW 10 129801664 missense probably damaging 1.00
R6707:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6708:Olfr811 UTSW 10 129801820 missense probably damaging 1.00
R6868:Olfr811 UTSW 10 129802168 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCACAAGCATTGTAGGAAATTGTTC -3'
(R):5'- TTGTCAGTCAAGTAATGTGGATGAG -3'

Sequencing Primer
(F):5'- AGGAAATTGTTCTGTCTCCTGAGAG -3'
(R):5'- AAGTTTCTATGGCCAAGAAAGAC -3'
Posted On2014-07-14