Incidental Mutation 'R1941:BC027072'
ID214041
Institutional Source Beutler Lab
Gene Symbol BC027072
Ensembl Gene ENSMUSG00000044375
Gene NamecDNA sequence BC027072
Synonyms
MMRRC Submission 039959-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R1941 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location71743557-71752885 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 71752068 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 205 (T205P)
Ref Sequence ENSEMBL: ENSMUSP00000051871 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057405]
Predicted Effect probably damaging
Transcript: ENSMUST00000057405
AA Change: T205P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000051871
Gene: ENSMUSG00000044375
AA Change: T205P

DomainStartEndE-ValueType
Pfam:Retinal 1 1255 N/A PFAM
Coding Region Coverage
  • 1x: 97.3%
  • 3x: 96.6%
  • 10x: 94.8%
  • 20x: 91.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly expressed in photoreceptors and may associate with the primary cilium of the outer segment. The encoded protein appears to undergo post-translational lipid modification. Nonsense and missense variants of this gene appear to cause a recessive form of retinitis pigmentosa. [provided by RefSeq, Jun 2010]
PHENOTYPE: Mice homozygous for a knock-out allele develop severe early-onset retinal degeneration associated with a disorganized outer segment, progressive thinning of the outer nuclear layer, microglia activation, decreased a- and b-wave amplitudes, and nearly undetectable ERG responses by 8 weeks of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Art2b A C 7: 101,580,317 F125C probably damaging Het
Camta1 T C 4: 151,075,155 Y1616C probably damaging Het
Cep162 T G 9: 87,199,995 I1286L probably benign Het
Chd9 T A 8: 90,977,069 probably null Het
Col11a2 T A 17: 34,044,951 S247T probably benign Het
Col6a4 T G 9: 106,075,010 D563A probably benign Het
Crebbp C T 16: 4,179,691 M176I probably benign Het
Cyp4a12b A G 4: 115,438,059 N454S probably damaging Het
Dhx8 T C 11: 101,752,198 probably null Het
Dock7 G A 4: 98,984,715 L1165F probably benign Het
Fam117a A T 11: 95,380,798 N399Y probably damaging Het
Fmn1 A G 2: 113,365,143 K396R unknown Het
Foxk1 T A 5: 142,456,674 V693E possibly damaging Het
Gml A G 15: 74,817,171 L10P probably damaging Het
Gpx8 A G 13: 113,046,275 L34P probably damaging Het
Kank2 A G 9: 21,772,866 L689P possibly damaging Het
Mt4 G A 8: 94,138,246 C16Y possibly damaging Het
Naa15 C A 3: 51,455,934 Y346* probably null Het
Ntrk3 C T 7: 78,247,262 V676I probably damaging Het
Oasl2 G A 5: 114,911,362 probably benign Het
Olfr376 T A 11: 73,375,621 F294I probably damaging Het
Olfr767 T G 10: 129,079,954 N3T probably damaging Het
Olfr811 T A 10: 129,802,412 M38L probably benign Het
Olfr835 A C 9: 19,035,866 T248P possibly damaging Het
Olfr860 G A 9: 19,845,950 S223F probably damaging Het
Otud7a C T 7: 63,729,826 R273* probably null Het
Pde11a C T 2: 76,291,250 R329Q probably benign Het
Pga5 G T 19: 10,669,456 probably null Het
Ppp1r1a A G 15: 103,533,101 probably null Het
Pus10 A G 11: 23,711,198 Q262R possibly damaging Het
Rbm17 T C 2: 11,589,074 K241R possibly damaging Het
Rp1l1 T G 14: 64,022,252 D114E probably damaging Het
Safb T A 17: 56,598,992 probably benign Het
Sgpl1 T C 10: 61,103,307 Y371C probably damaging Het
Siglec1 C A 2: 131,078,131 A827S possibly damaging Het
Smg5 T A 3: 88,345,380 S158T possibly damaging Het
Sp2 C T 11: 96,955,936 C527Y probably damaging Het
Spaca6 A G 17: 17,838,402 I71V probably benign Het
Spaca6 A G 17: 17,838,430 E80G probably damaging Het
Steap1 C A 5: 5,740,541 A136S probably damaging Het
Supv3l1 G C 10: 62,449,612 P25R probably benign Het
Tex21 T C 12: 76,221,684 K108R possibly damaging Het
Tnc A G 4: 64,014,964 Y688H probably damaging Het
Tnr G A 1: 159,850,134 E30K possibly damaging Het
Tnrc18 G T 5: 142,815,150 P18T probably damaging Het
Ttk T G 9: 83,853,126 S422A probably benign Het
Ubap1 A G 4: 41,378,968 K61E probably damaging Het
Ubr2 C T 17: 46,974,026 R522H probably damaging Het
Vwf A T 6: 125,639,279 E1185D possibly damaging Het
Wwp2 A G 8: 107,517,915 T194A probably benign Het
Zfp36 A G 7: 28,377,646 V279A probably damaging Het
Zfp870 C A 17: 32,882,804 R517L possibly damaging Het
Other mutations in BC027072
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02010:BC027072 APN 17 71749464 missense probably benign 0.38
IGL02033:BC027072 APN 17 71751081 missense probably damaging 1.00
IGL02711:BC027072 APN 17 71749382 missense probably benign 0.15
IGL03185:BC027072 APN 17 71749337 missense probably damaging 0.98
IGL03242:BC027072 APN 17 71750271 missense probably benign 0.01
R0367:BC027072 UTSW 17 71750476 missense probably damaging 1.00
R0413:BC027072 UTSW 17 71752217 missense probably benign 0.38
R0465:BC027072 UTSW 17 71750160 missense probably benign 0.42
R0535:BC027072 UTSW 17 71752439 missense probably benign 0.01
R0681:BC027072 UTSW 17 71749514 missense probably benign 0.00
R0736:BC027072 UTSW 17 71744664 missense probably benign 0.00
R1406:BC027072 UTSW 17 71749161 missense probably benign 0.18
R1406:BC027072 UTSW 17 71749161 missense probably benign 0.18
R1530:BC027072 UTSW 17 71749478 missense probably benign 0.01
R1723:BC027072 UTSW 17 71750378 missense probably damaging 1.00
R2179:BC027072 UTSW 17 71752526 missense probably damaging 1.00
R2232:BC027072 UTSW 17 71749284 missense probably benign 0.00
R2519:BC027072 UTSW 17 71751647 missense probably damaging 1.00
R2997:BC027072 UTSW 17 71744711 critical splice acceptor site probably benign
R3899:BC027072 UTSW 17 71750160 missense probably benign 0.00
R4890:BC027072 UTSW 17 71752311 missense possibly damaging 0.50
R4898:BC027072 UTSW 17 71751071 missense probably damaging 1.00
R5347:BC027072 UTSW 17 71749935 missense probably benign 0.00
R5436:BC027072 UTSW 17 71750842 missense probably damaging 1.00
R5527:BC027072 UTSW 17 71752640 missense probably damaging 1.00
R5556:BC027072 UTSW 17 71752425 missense possibly damaging 0.81
R5625:BC027072 UTSW 17 71751326 missense probably damaging 1.00
R5707:BC027072 UTSW 17 71751572 missense possibly damaging 0.90
R5932:BC027072 UTSW 17 71751753 missense probably damaging 1.00
R6043:BC027072 UTSW 17 71750042 missense probably damaging 1.00
R6314:BC027072 UTSW 17 71752457 missense probably benign 0.04
R6513:BC027072 UTSW 17 71744706 missense probably damaging 1.00
X0035:BC027072 UTSW 17 71744711 critical splice acceptor site probably benign
Predicted Primers PCR Primer
(F):5'- ATCTGAGACAGCTGCTGGAG -3'
(R):5'- AGTGTGCCATCAACCAGAC -3'

Sequencing Primer
(F):5'- TGACTGTGTACTGCAGCAGC -3'
(R):5'- GACAGCCAGGACCATTGC -3'
Posted On2014-07-14