Incidental Mutation 'R0126:Crebbp'
ID21411
Institutional Source Beutler Lab
Gene Symbol Crebbp
Ensembl Gene ENSMUSG00000022521
Gene NameCREB binding protein
SynonymsKAT3A, CBP
MMRRC Submission 038411-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0126 (G1)
Quality Score167
Status Validated (trace)
Chromosome16
Chromosomal Location4081328-4213997 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 4084063 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 2399 (F2399L)
Ref Sequence ENSEMBL: ENSMUSP00000146330 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023165] [ENSMUST00000205765]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023165
AA Change: F2437L

PolyPhen 2 Score 0.743 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000023165
Gene: ENSMUSG00000022521
AA Change: F2437L

DomainStartEndE-ValueType
low complexity region 47 58 N/A INTRINSIC
low complexity region 75 89 N/A INTRINSIC
low complexity region 95 105 N/A INTRINSIC
low complexity region 213 233 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
ZnF_TAZ 347 432 2.31e-32 SMART
low complexity region 494 516 N/A INTRINSIC
Pfam:KIX 586 666 1.4e-42 PFAM
low complexity region 874 893 N/A INTRINSIC
low complexity region 909 958 N/A INTRINSIC
low complexity region 1045 1065 N/A INTRINSIC
BROMO 1085 1195 4.26e-43 SMART
Blast:KAT11 1265 1308 3e-15 BLAST
KAT11 1343 1649 4.25e-137 SMART
ZnF_ZZ 1702 1743 2.17e-15 SMART
ZnF_TAZ 1767 1845 6.8e-30 SMART
low complexity region 1847 1877 N/A INTRINSIC
low complexity region 1884 1914 N/A INTRINSIC
low complexity region 1942 1971 N/A INTRINSIC
Pfam:Creb_binding 2019 2115 8.2e-38 PFAM
low complexity region 2147 2161 N/A INTRINSIC
low complexity region 2197 2216 N/A INTRINSIC
low complexity region 2260 2279 N/A INTRINSIC
low complexity region 2286 2304 N/A INTRINSIC
low complexity region 2343 2378 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191387
Predicted Effect possibly damaging
Transcript: ENSMUST00000205765
AA Change: F2399L

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205945
Predicted Effect probably benign
Transcript: ENSMUST00000206464
Meta Mutation Damage Score 0.158 question?
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.6%
  • 10x: 93.2%
  • 20x: 81.8%
Validation Efficiency 98% (102/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is ubiquitously expressed and is involved in the transcriptional coactivation of many different transcription factors. First isolated as a nuclear protein that binds to cAMP-response element binding protein (CREB), this gene is now known to play critical roles in embryonic development, growth control, and homeostasis by coupling chromatin remodeling to transcription factor recognition. The protein encoded by this gene has intrinsic histone acetyltransferase activity and also acts as a scaffold to stabilize additional protein interactions with the transcription complex. This protein acetylates both histone and non-histone proteins. This protein shares regions of very high sequence similarity with protein p300 in its bromodomain, cysteine-histidine-rich regions, and histone acetyltransferase domain. Mutations in this gene cause Rubinstein-Taybi syndrome (RTS). Chromosomal translocations involving this gene have been associated with acute myeloid leukemia. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygotes for null or altered alleles die around midgestation with defects in hemopoiesis, blood vessel formation, and neural tube closure. Heterozygotes may exhibit skeletal, cardiac, and hematopoietic defects, retarded growth, and hematologic tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 T C 2: 25,443,730 L1730P possibly damaging Het
Adam9 T C 8: 24,970,737 N577S probably damaging Het
Add1 T C 5: 34,613,579 Y316H probably benign Het
Agpat3 T C 10: 78,278,056 D266G probably null Het
Aldh3a2 C A 11: 61,224,558 Q524H probably benign Het
Alox12b A C 11: 69,167,471 S550R probably benign Het
Ano4 T A 10: 88,952,292 I753F possibly damaging Het
AW011738 T A 4: 156,203,647 probably benign Het
B4galt3 C T 1: 171,276,165 T103M probably damaging Het
Cabs1 C T 5: 87,980,195 T235I probably damaging Het
Casc4 T C 2: 121,906,084 probably benign Het
Casq2 A G 3: 102,133,399 H272R probably damaging Het
Ccdc180 T C 4: 45,912,866 probably null Het
Cdh12 A T 15: 21,583,945 M624L probably benign Het
Cdh5 A C 8: 104,140,682 probably null Het
Col7a1 A G 9: 108,969,583 probably benign Het
Cpne2 A T 8: 94,554,933 I199F probably damaging Het
Defb36 T C 2: 152,612,579 C53R probably damaging Het
Degs1 T C 1: 182,279,692 M1V probably null Het
Disp2 T A 2: 118,790,338 F517Y probably damaging Het
Dnah5 A G 15: 28,246,319 D601G probably benign Het
Dnpep G A 1: 75,312,538 Q310* probably null Het
Dsg1a A G 18: 20,340,878 T1003A probably benign Het
Fbrsl1 C G 5: 110,396,040 probably benign Het
Foxh1 A T 15: 76,669,254 L116H probably damaging Het
Gigyf2 G A 1: 87,411,875 probably benign Het
Gp1ba A T 11: 70,641,033 probably benign Het
Gucy1b1 A G 3: 82,037,911 probably benign Het
Gucy2g T G 19: 55,241,166 D24A probably benign Het
Hirip3 A G 7: 126,863,442 K190R probably damaging Het
Hmmr T C 11: 40,705,954 N717D probably damaging Het
Il12b A T 11: 44,410,218 Y187F probably damaging Het
Iqgap1 A G 7: 80,738,322 I859T probably benign Het
Jmjd1c T C 10: 67,219,326 L175P probably damaging Het
Klc2 T C 19: 5,112,746 M242V possibly damaging Het
Klf3 T C 5: 64,822,103 M96T probably benign Het
Lrrc66 G T 5: 73,607,088 H871N probably benign Het
Ltn1 A T 16: 87,425,640 D168E probably benign Het
Mak T C 13: 41,032,596 D532G probably damaging Het
March6 A G 15: 31,462,005 M859T probably benign Het
Mlxipl C A 5: 135,132,323 N365K probably damaging Het
Mplkip T C 13: 17,695,752 S90P possibly damaging Het
Myo5c A T 9: 75,269,525 H584L probably benign Het
Myt1l A G 12: 29,851,720 T228A possibly damaging Het
Nxpe3 A T 16: 55,866,229 Y139N possibly damaging Het
Olfr1090 T A 2: 86,754,637 I34L probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr568 A G 7: 102,877,140 T7A probably benign Het
Pak6 C T 2: 118,690,332 S268F possibly damaging Het
Parp10 G A 15: 76,243,066 A57V probably damaging Het
Pik3r3 T A 4: 116,256,268 D69E probably damaging Het
Polr2a T G 11: 69,747,425 K105T probably damaging Het
Prdm16 A T 4: 154,328,838 probably benign Het
Prepl G A 17: 85,083,242 T96I probably benign Het
Ret C T 6: 118,165,995 probably benign Het
Rgl3 A T 9: 21,975,812 D541E probably benign Het
Rpa1 A C 11: 75,318,529 Y143D probably benign Het
Rps16 T A 7: 28,351,083 L47Q probably damaging Het
Sbno2 A T 10: 80,068,853 probably null Het
Scube1 A T 15: 83,621,063 N385K probably damaging Het
Shank2 A G 7: 144,031,355 E31G probably damaging Het
Slc38a9 G T 13: 112,729,257 C496F possibly damaging Het
Snap47 A G 11: 59,437,987 V163A probably damaging Het
Sntg2 T C 12: 30,201,261 probably benign Het
Sp7 C A 15: 102,358,460 V322F probably damaging Het
Spic T C 10: 88,676,062 K111E probably damaging Het
Sqor T C 2: 122,798,027 probably benign Het
St6galnac1 T A 11: 116,766,584 M385L probably benign Het
Synpo2 A T 3: 123,079,862 S1211T possibly damaging Het
Sytl2 T A 7: 90,396,589 V638E probably damaging Het
Taar1 T A 10: 23,920,547 S48T probably benign Het
Tbx18 T A 9: 87,729,653 D108V possibly damaging Het
Tdh C T 14: 63,497,593 probably benign Het
Tldc1 T C 8: 119,762,350 D398G possibly damaging Het
Tlr9 T A 9: 106,225,682 L724Q probably benign Het
Tmem270 T A 5: 134,902,788 Y100F probably benign Het
Trim65 G C 11: 116,124,604 probably benign Het
Trrap A T 5: 144,805,750 K1393* probably null Het
Ttc13 A G 8: 124,683,291 V523A probably damaging Het
Utrn T A 10: 12,711,475 D939V probably benign Het
Vmn1r46 G T 6: 89,976,953 M261I probably benign Het
Vwa5a A G 9: 38,737,807 probably null Het
Zfp108 A T 7: 24,260,724 T247S probably benign Het
Zfp366 A T 13: 99,228,621 I97F probably benign Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Crebbp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Crebbp APN 16 4179552 missense probably benign
IGL01366:Crebbp APN 16 4126506 missense probably damaging 1.00
IGL01457:Crebbp APN 16 4124768 missense probably damaging 0.99
IGL01713:Crebbp APN 16 4128648 missense possibly damaging 0.79
IGL02382:Crebbp APN 16 4108070 missense probably damaging 1.00
IGL02513:Crebbp APN 16 4126605 unclassified probably null
IGL02519:Crebbp APN 16 4101593 missense possibly damaging 0.80
IGL02533:Crebbp APN 16 4107432 missense probably damaging 1.00
IGL02582:Crebbp APN 16 4084277 missense possibly damaging 0.87
IGL02600:Crebbp APN 16 4155018 missense probably benign
IGL02716:Crebbp APN 16 4114878 missense probably benign 0.22
IGL02736:Crebbp APN 16 4154910 missense probably benign 0.00
IGL03349:Crebbp APN 16 4117358 missense possibly damaging 0.69
PIT4418001:Crebbp UTSW 16 4114825 missense probably benign 0.02
R0022:Crebbp UTSW 16 4085228 missense probably damaging 1.00
R0029:Crebbp UTSW 16 4117443 missense probably damaging 1.00
R0098:Crebbp UTSW 16 4091928 missense probably damaging 1.00
R0098:Crebbp UTSW 16 4091928 missense probably damaging 1.00
R0125:Crebbp UTSW 16 4117241 splice site probably benign
R0140:Crebbp UTSW 16 4117499 missense probably damaging 1.00
R0546:Crebbp UTSW 16 4085807 missense probably damaging 0.99
R0705:Crebbp UTSW 16 4155010 missense possibly damaging 0.95
R0801:Crebbp UTSW 16 4088276 missense probably damaging 1.00
R1103:Crebbp UTSW 16 4084061 missense probably damaging 0.97
R1225:Crebbp UTSW 16 4126956 missense probably benign 0.04
R1421:Crebbp UTSW 16 4124647 missense probably damaging 1.00
R1513:Crebbp UTSW 16 4115885 missense probably damaging 1.00
R1531:Crebbp UTSW 16 4084517 missense probably benign 0.04
R1860:Crebbp UTSW 16 4087736 missense possibly damaging 0.68
R1941:Crebbp UTSW 16 4179691 missense probably benign
R1953:Crebbp UTSW 16 4179449 missense probably benign 0.23
R1992:Crebbp UTSW 16 4128697 splice site probably null
R2000:Crebbp UTSW 16 4084252 missense probably damaging 0.98
R2006:Crebbp UTSW 16 4084753 unclassified probably benign
R2022:Crebbp UTSW 16 4085819 missense probably damaging 1.00
R2044:Crebbp UTSW 16 4084823 missense probably benign 0.04
R2185:Crebbp UTSW 16 4084138 missense probably damaging 0.99
R2203:Crebbp UTSW 16 4138777 missense possibly damaging 0.72
R2349:Crebbp UTSW 16 4138910 missense probably damaging 1.00
R2430:Crebbp UTSW 16 4096465 missense probably damaging 1.00
R2438:Crebbp UTSW 16 4154858 missense possibly damaging 0.90
R2842:Crebbp UTSW 16 4109198 missense probably damaging 1.00
R2896:Crebbp UTSW 16 4138816 missense probably damaging 1.00
R2920:Crebbp UTSW 16 4119082 missense probably damaging 0.98
R3118:Crebbp UTSW 16 4109198 missense probably damaging 1.00
R3894:Crebbp UTSW 16 4096102 missense probably benign 0.11
R4177:Crebbp UTSW 16 4119799 missense possibly damaging 0.48
R4692:Crebbp UTSW 16 4114863 missense possibly damaging 0.64
R4790:Crebbp UTSW 16 4180119 missense probably damaging 0.98
R4884:Crebbp UTSW 16 4088375 missense probably damaging 1.00
R4957:Crebbp UTSW 16 4117367 missense probably benign 0.14
R5109:Crebbp UTSW 16 4088431 intron probably benign
R5121:Crebbp UTSW 16 4093511 missense probably damaging 1.00
R5420:Crebbp UTSW 16 4107458 missense probably damaging 1.00
R5455:Crebbp UTSW 16 4085967 missense probably benign 0.45
R5485:Crebbp UTSW 16 4114913 missense probably benign
R5660:Crebbp UTSW 16 4154858 missense possibly damaging 0.90
R5724:Crebbp UTSW 16 4087635 unclassified probably benign
R5771:Crebbp UTSW 16 4119772 missense probably benign 0.03
R5825:Crebbp UTSW 16 4087742 missense probably damaging 0.99
R5919:Crebbp UTSW 16 4108127 missense probably damaging 1.00
R5965:Crebbp UTSW 16 4087661 unclassified probably benign
R6021:Crebbp UTSW 16 4085418 missense probably damaging 1.00
R6146:Crebbp UTSW 16 4084623 nonsense probably null
R6521:Crebbp UTSW 16 4119128 missense probably damaging 0.99
R6571:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6617:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6618:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6634:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6646:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6647:Crebbp UTSW 16 4119806 missense possibly damaging 0.92
R6766:Crebbp UTSW 16 4117500 missense probably damaging 1.00
R6836:Crebbp UTSW 16 4180022 missense possibly damaging 0.83
R7022:Crebbp UTSW 16 4117323 missense probably damaging 0.98
X0012:Crebbp UTSW 16 4087765 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACTTGGGAGTCACAGTCCCATC -3'
(R):5'- GCAGATCGCCACATCCCTTAGTAAC -3'

Sequencing Primer
(F):5'- GGGAGGAGaaaaacaaaacaaaac -3'
(R):5'- TTAGTAACCAGGTGCGATCTC -3'
Posted On2013-04-11