Incidental Mutation 'R1899:Smtn'
ID214111
Institutional Source Beutler Lab
Gene Symbol Smtn
Ensembl Gene ENSMUSG00000020439
Gene Namesmoothelin
Synonyms
MMRRC Submission 039919-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.478) question?
Stock #R1899 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location3517523-3540612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 3531326 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 223 (A223D)
Ref Sequence ENSEMBL: ENSMUSP00000133155 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020718] [ENSMUST00000020721] [ENSMUST00000075118] [ENSMUST00000110011] [ENSMUST00000136243] [ENSMUST00000156201] [ENSMUST00000170588]
Predicted Effect probably benign
Transcript: ENSMUST00000020718
SMART Domains Protein: ENSMUSP00000020718
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 26 38 N/A INTRINSIC
coiled coil region 41 74 N/A INTRINSIC
low complexity region 75 100 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
Pfam:Smoothelin 154 208 1e-23 PFAM
low complexity region 212 236 N/A INTRINSIC
CH 322 421 1.04e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000020721
AA Change: A223D

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020721
Gene: ENSMUSG00000020439
AA Change: A223D

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.7e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 906 1.04e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000075118
AA Change: A223D

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000074621
Gene: ENSMUSG00000020439
AA Change: A223D

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.8e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 907 9.51e-26 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000110011
AA Change: A223D

PolyPhen 2 Score 0.532 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000105638
Gene: ENSMUSG00000020439
AA Change: A223D

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 2.5e-14 PFAM
Pfam:Smoothelin 72 122 8.5e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 568 617 6e-25 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 930 1.62e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123459
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128806
Predicted Effect probably benign
Transcript: ENSMUST00000136243
SMART Domains Protein: ENSMUSP00000117307
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 2.3e-16 PFAM
Pfam:Smoothelin 68 122 6.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154861
Predicted Effect probably benign
Transcript: ENSMUST00000156201
SMART Domains Protein: ENSMUSP00000118750
Gene: ENSMUSG00000020439

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 3.4e-13 PFAM
Pfam:Smoothelin 68 122 1e-16 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000170588
AA Change: A223D

PolyPhen 2 Score 0.895 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133155
Gene: ENSMUSG00000020439
AA Change: A223D

DomainStartEndE-ValueType
Pfam:Smoothelin 1 41 1.7e-15 PFAM
Pfam:Smoothelin 68 122 6.8e-19 PFAM
low complexity region 159 180 N/A INTRINSIC
low complexity region 192 205 N/A INTRINSIC
low complexity region 233 257 N/A INTRINSIC
low complexity region 366 391 N/A INTRINSIC
Pfam:Smoothelin 563 617 2.7e-23 PFAM
low complexity region 697 721 N/A INTRINSIC
CH 807 906 1.04e-22 SMART
Meta Mutation Damage Score 0.676 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.6%
  • 20x: 93.4%
Validation Efficiency 94% (94/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a structural protein that is found exclusively in contractile smooth muscle cells. It associates with stress fibers and constitutes part of the cytoskeleton. This gene is localized to chromosome 22q12.3, distal to the TUPLE1 locus and outside the DiGeorge syndrome deletion. Alternative splicing of this gene results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2011]
PHENOTYPE: Mice homozygous for disruptions of both the A and B isoforms of this gene display partial postnatal lethality, impaired intestinal smooth muscle contractility and thus hampered intestinal transit and diverticulosis. Mice lacking only the B isoform appearnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 98 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610009O20Rik T C 18: 38,258,342 W378R probably benign Het
4930522L14Rik T A 5: 109,736,798 Q398L probably benign Het
4930596D02Rik T G 14: 35,810,132 K162T probably damaging Het
Abca8b G T 11: 109,937,918 T1353K possibly damaging Het
Abcg3 A C 5: 104,938,199 C565G probably damaging Het
Actr3b G A 5: 25,829,538 V185I possibly damaging Het
Akap6 A T 12: 53,141,852 E2016D possibly damaging Het
Aldh3b2 T C 19: 3,978,662 V148A possibly damaging Het
Ankfy1 C T 11: 72,754,407 Q771* probably null Het
Anks1b A G 10: 90,260,756 D425G probably damaging Het
Arrb1 T C 7: 99,582,297 probably benign Het
Atg2a C A 19: 6,245,067 T170N probably damaging Het
Atp8b5 C T 4: 43,361,804 R617C possibly damaging Het
Bicra T C 7: 15,987,751 T614A possibly damaging Het
Cacna1i A G 15: 80,391,642 D167G possibly damaging Het
Calr4 T G 4: 109,246,293 probably null Het
Camsap3 G T 8: 3,603,922 E515* probably null Het
Casp8ap2 T C 4: 32,643,647 S907P probably damaging Het
Cdk19 T A 10: 40,479,780 probably benign Het
Chst14 A G 2: 118,927,015 M122V possibly damaging Het
Cntn4 A G 6: 106,675,813 M748V probably benign Het
Col7a1 A G 9: 108,978,888 D2552G unknown Het
Cpeb2 C A 5: 43,277,587 P600Q probably damaging Het
Cyp2a5 C T 7: 26,839,033 R274* probably null Het
Dexi A G 16: 10,542,518 F58S probably damaging Het
Dlg5 C A 14: 24,148,300 G1522W probably damaging Het
Dock2 T C 11: 34,294,286 H1048R probably benign Het
Dpp4 T C 2: 62,345,050 probably benign Het
Dusp10 A T 1: 184,069,180 K381N possibly damaging Het
Ercc4 A G 16: 13,147,787 E761G probably damaging Het
Ern2 T C 7: 122,183,842 probably benign Het
Fam83f A T 15: 80,692,080 T311S probably damaging Het
Fat2 T C 11: 55,262,178 D3736G probably benign Het
Fgf11 G T 11: 69,801,453 T58K probably benign Het
Galntl5 C G 5: 25,198,532 S167* probably null Het
Glg1 T G 8: 111,165,674 E846D probably benign Het
Grm8 C A 6: 28,125,895 E77D probably damaging Het
Hmcn1 A T 1: 150,657,451 D3028E probably damaging Het
Htt A G 5: 34,907,085 I2943V probably benign Het
Ift80 T C 3: 68,918,513 K498R probably benign Het
Ipo9 A T 1: 135,400,146 M509K probably damaging Het
Kcnj3 T C 2: 55,437,244 V15A probably damaging Het
Kcnn3 A T 3: 89,520,455 probably benign Het
Larp1b T A 3: 40,964,084 D53E probably benign Het
Ltf T C 9: 111,022,845 F117L possibly damaging Het
Maml1 A G 11: 50,266,130 L406P probably damaging Het
Mnx1 G A 5: 29,473,957 A376V unknown Het
Mroh2a G A 1: 88,235,376 R376H probably benign Het
Mrpl4 A G 9: 21,006,831 Y111C probably damaging Het
Mto1 T C 9: 78,461,517 probably benign Het
Nalcn A T 14: 123,316,126 M972K possibly damaging Het
Nemf T C 12: 69,346,378 I225V probably null Het
Nipal4 T G 11: 46,150,231 D379A probably damaging Het
Nktr A G 9: 121,748,866 probably benign Het
Nlrp5 A G 7: 23,404,797 T28A probably benign Het
Nxph1 T A 6: 9,247,622 Y198N probably damaging Het
Olfr1037 A T 2: 86,085,720 V19D probably benign Het
Olfr1230 T C 2: 89,296,670 N200S probably damaging Het
Olfr1436 T C 19: 12,298,343 Y263C probably damaging Het
P2rx7 A G 5: 122,673,736 Y370C probably benign Het
Piezo1 T C 8: 122,482,645 probably benign Het
Piezo1 T C 8: 122,489,566 D1401G probably damaging Het
Plxnd1 A G 6: 115,969,363 L879P probably benign Het
Polr2a A T 11: 69,743,946 I636N probably damaging Het
Prex2 G T 1: 11,162,366 E886* probably null Het
Proca1 A T 11: 78,205,021 I73F probably damaging Het
Prss55 A T 14: 64,079,390 V101E probably benign Het
Psg26 T A 7: 18,478,425 H335L probably benign Het
Rai1 A G 11: 60,185,920 E270G probably benign Het
Reep1 A G 6: 71,780,797 N127D probably benign Het
Rims1 G T 1: 22,428,474 P769Q probably damaging Het
Robo4 A T 9: 37,404,070 probably benign Het
Ryr2 A T 13: 11,591,336 D888E probably benign Het
Scamp3 A G 3: 89,180,260 N135D probably damaging Het
Sdk2 C T 11: 113,838,646 silent Het
Sema4f A G 6: 82,918,029 M395T probably benign Het
Sgip1 T C 4: 102,968,337 probably null Het
Sik2 A T 9: 50,995,674 probably benign Het
Spen T C 4: 141,470,343 T3405A probably benign Het
Srebf1 A G 11: 60,203,486 L601P probably damaging Het
Srsf11 A T 3: 158,031,580 probably benign Het
Tacc2 T G 7: 130,624,202 S891R possibly damaging Het
Tbc1d17 T A 7: 44,841,633 probably benign Het
Tgfbr3l C A 8: 4,249,600 R128S probably damaging Het
Thsd1 G A 8: 22,252,318 probably benign Het
Tlx3 T C 11: 33,203,072 S130G probably benign Het
Tmem25 A T 9: 44,798,216 probably null Het
Trak2 A T 1: 58,946,336 M1K probably null Het
Trappc12 C T 12: 28,746,985 E183K probably damaging Het
Ubl3 A G 5: 148,509,280 V71A possibly damaging Het
Unc50 A G 1: 37,438,799 Y254C probably damaging Het
Unkl T C 17: 25,229,460 probably null Het
Uso1 T A 5: 92,201,192 S819T probably benign Het
Yes1 A T 5: 32,645,051 R103S probably damaging Het
Zfp131 A G 13: 119,767,025 V396A probably damaging Het
Zfp553 T C 7: 127,235,654 I127T possibly damaging Het
Zfp599 A T 9: 22,251,549 N102K probably benign Het
Zmynd10 A T 9: 107,550,037 Q288L probably benign Het
Other mutations in Smtn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01124:Smtn APN 11 3526326 critical splice donor site probably null
IGL02335:Smtn APN 11 3526215 missense probably damaging 1.00
IGL02473:Smtn APN 11 3532463 missense probably damaging 1.00
IGL02678:Smtn APN 11 3526353 missense possibly damaging 0.95
IGL02824:Smtn APN 11 3532658 missense probably damaging 1.00
IGL03067:Smtn APN 11 3530165 missense possibly damaging 0.53
IGL03142:Smtn APN 11 3532601 nonsense probably null
runtish UTSW 11 3531326 missense possibly damaging 0.89
R0279:Smtn UTSW 11 3530235 missense probably damaging 0.99
R0523:Smtn UTSW 11 3524664 missense possibly damaging 0.89
R0855:Smtn UTSW 11 3521880 missense probably damaging 1.00
R1080:Smtn UTSW 11 3517693 missense probably damaging 1.00
R1218:Smtn UTSW 11 3530021 missense probably benign
R1571:Smtn UTSW 11 3530102 missense probably benign 0.00
R2033:Smtn UTSW 11 3517781 missense probably benign 0.43
R2126:Smtn UTSW 11 3530045 missense probably benign 0.02
R2358:Smtn UTSW 11 3532865 splice site probably null
R3690:Smtn UTSW 11 3527687 intron probably benign
R3712:Smtn UTSW 11 3532865 splice site probably null
R4108:Smtn UTSW 11 3526449 missense probably benign 0.10
R4709:Smtn UTSW 11 3524663 missense probably damaging 0.99
R4710:Smtn UTSW 11 3524663 missense probably damaging 0.99
R4830:Smtn UTSW 11 3520736 intron probably benign
R4944:Smtn UTSW 11 3522916 missense probably damaging 1.00
R4959:Smtn UTSW 11 3527825 start codon destroyed probably null
R5223:Smtn UTSW 11 3529530 missense probably benign 0.00
R5554:Smtn UTSW 11 3520811 nonsense probably null
R5610:Smtn UTSW 11 3529582 missense probably damaging 1.00
R5636:Smtn UTSW 11 3517829 critical splice acceptor site probably null
R5972:Smtn UTSW 11 3533486 missense probably damaging 1.00
R6108:Smtn UTSW 11 3529608 missense probably damaging 0.99
R6227:Smtn UTSW 11 3527624 intron probably benign
R7016:Smtn UTSW 11 3530368 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGGAACTCACCTGTCTGGC -3'
(R):5'- AGAAACCTTGGTTGCGTCCTG -3'

Sequencing Primer
(F):5'- GAACTCACCTGTCTGGCATCCC -3'
(R):5'- TCTTCTGCAGGTGCCAGAG -3'
Posted On2014-07-14