Incidental Mutation 'R1900:Nox4'
ID214193
Institutional Source Beutler Lab
Gene Symbol Nox4
Ensembl Gene ENSMUSG00000030562
Gene NameNADPH oxidase 4
Synonyms
MMRRC Submission 039920-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.457) question?
Stock #R1900 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location87246096-87398710 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 87360796 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 402 (R402*)
Ref Sequence ENSEMBL: ENSMUSP00000070039 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032781] [ENSMUST00000068829] [ENSMUST00000126887] [ENSMUST00000136577] [ENSMUST00000144267]
Predicted Effect probably null
Transcript: ENSMUST00000032781
AA Change: R402*
SMART Domains Protein: ENSMUSP00000032781
Gene: ENSMUSG00000030562
AA Change: R402*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 8.3e-21 PFAM
Pfam:FAD_binding_8 306 417 2.8e-17 PFAM
Pfam:NAD_binding_6 423 561 7.3e-24 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000068829
AA Change: R402*
SMART Domains Protein: ENSMUSP00000070039
Gene: ENSMUSG00000030562
AA Change: R402*

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Ferric_reduct 58 205 5.3e-27 PFAM
Pfam:FAD_binding_8 306 417 5.5e-17 PFAM
Pfam:NAD_binding_6 423 539 4.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126887
SMART Domains Protein: ENSMUSP00000138336
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000136577
SMART Domains Protein: ENSMUSP00000138274
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144267
SMART Domains Protein: ENSMUSP00000138143
Gene: ENSMUSG00000030562

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Meta Mutation Damage Score 0.594 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOX-family of enzymes that functions as the catalytic subunit the NADPH oxidase complex. The encoded protein is localized to non-phagocytic cells where it acts as an oxygen sensor and catalyzes the reduction of molecular oxygen to various reactive oxygen species (ROS). The ROS generated by this protein have been implicated in numerous biological functions including signal transduction, cell differentiation and tumor cell growth. A pseudogene has been identified on the other arm of chromosome 11. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for a null allele display increased heart damage following pressure overload. Mice with a cardiomyocyte specific deletion show decreased damage following pressure overload. Mice homozygous for a different knock-out allele exhibit decreased suseptibility to bleomycin-induced fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,770,583 T478A probably damaging Het
6330409D20Rik T C 2: 32,740,547 probably benign Het
Ago4 T C 4: 126,516,936 I221V probably benign Het
Ankfy1 C T 11: 72,754,407 Q771* probably null Het
Ankrd50 T C 3: 38,455,387 T944A probably damaging Het
AU040320 A C 4: 126,853,280 probably null Het
Axdnd1 A G 1: 156,380,774 probably null Het
Cdadc1 A T 14: 59,586,532 D170E probably damaging Het
Cep164 C A 9: 45,809,825 R93L probably damaging Het
Cep250 T C 2: 155,985,374 probably null Het
Cfdp1 G A 8: 111,768,729 R286* probably null Het
Chrdl2 A G 7: 100,033,664 I377V possibly damaging Het
Cntrob A T 11: 69,308,054 S623T probably benign Het
Col6a5 C T 9: 105,931,213 G879S unknown Het
Cyp2c38 T A 19: 39,438,312 I182F probably benign Het
Dennd4a T C 9: 64,897,336 V1319A probably damaging Het
Dysf T G 6: 84,039,567 V70G probably damaging Het
Edn3 A G 2: 174,761,605 T49A possibly damaging Het
Elac1 C G 18: 73,739,245 L226F probably damaging Het
Eps8l3 A G 3: 107,890,952 D445G probably benign Het
Fam71a T A 1: 191,164,434 K4M possibly damaging Het
Fgf11 G T 11: 69,801,453 T58K probably benign Het
Fstl5 T A 3: 76,708,160 W843R probably damaging Het
Fyb2 A G 4: 104,945,455 R185G probably benign Het
Gal3st2c G A 1: 94,009,044 R237H probably damaging Het
Galnt15 G T 14: 32,049,865 R289L probably damaging Het
Gdf5 T A 2: 155,942,081 D317V probably damaging Het
Gm10436 A C 12: 88,177,260 L261R probably benign Het
Gm7808 A G 9: 19,928,114 probably benign Het
Hcn3 T C 3: 89,148,263 E559G probably benign Het
Hdlbp A T 1: 93,422,237 probably benign Het
Hhip T C 8: 79,975,046 T620A probably benign Het
Hs3st3a1 T C 11: 64,520,442 S269P probably damaging Het
Il17ra A T 6: 120,477,394 probably null Het
Kif2a T C 13: 106,976,995 N417S possibly damaging Het
Klhl41 T A 2: 69,674,619 probably benign Het
L3mbtl4 G T 17: 68,459,805 C169F probably damaging Het
Lap3 T C 5: 45,511,910 F467S probably damaging Het
Lpar6 A T 14: 73,239,139 Y180F probably benign Het
Lrig3 T C 10: 126,002,393 probably benign Het
Ltbp2 A T 12: 84,830,658 S378T probably damaging Het
Ltf T C 9: 111,022,845 F117L possibly damaging Het
Med16 T C 10: 79,898,931 E533G probably damaging Het
Meltf T C 16: 31,881,969 probably null Het
Mphosph10 C T 7: 64,381,028 E488K possibly damaging Het
Mroh1 A G 15: 76,433,385 T812A probably benign Het
Mto1 T C 9: 78,461,517 probably benign Het
Ndst1 A T 18: 60,712,721 probably null Het
Ndst4 T A 3: 125,697,895 probably null Het
Nhlh1 A T 1: 172,054,041 I86N probably damaging Het
Nme9 A C 9: 99,459,774 D59A probably damaging Het
Npr1 T C 3: 90,462,188 D410G probably damaging Het
Nrip1 T A 16: 76,292,039 T877S probably benign Het
Nsd2 A G 5: 33,846,169 N221S probably benign Het
Olfr1230 T C 2: 89,296,670 N200S probably damaging Het
Olfr1463 T A 19: 13,234,913 I221K possibly damaging Het
Olfr23 C A 11: 73,940,660 P138Q possibly damaging Het
Olfr250 A T 9: 38,368,064 I173L probably benign Het
Olfr561 A T 7: 102,775,331 H269L probably benign Het
Olfr61 A T 7: 140,638,592 D297V probably damaging Het
Olfr616 A T 7: 103,564,607 L224* probably null Het
Ophn1 A T X: 98,726,059 Y181* probably null Het
Parp1 A G 1: 180,597,339 K819R probably damaging Het
Parp9 T C 16: 35,972,221 S829P probably benign Het
Pde6c T A 19: 38,161,940 F511Y probably damaging Het
Per3 G T 4: 151,041,426 H145Q probably damaging Het
Pglyrp1 C T 7: 18,890,226 R145W probably damaging Het
Piezo1 T C 8: 122,482,645 probably benign Het
Plb1 T C 5: 32,286,847 I312T probably benign Het
Plin3 T A 17: 56,279,824 T408S possibly damaging Het
Polr2a A T 11: 69,743,946 I636N probably damaging Het
Prex2 G T 1: 11,162,366 E886* probably null Het
Proca1 A T 11: 78,205,021 I73F probably damaging Het
Prpmp5 A T 6: 132,314,698 L11Q unknown Het
Ptpn6 A G 6: 124,728,933 S83P probably benign Het
Rtp1 G T 16: 23,429,299 V41L probably benign Het
Scn4a A G 11: 106,327,533 I1035T probably damaging Het
Sell A T 1: 164,065,338 Y41F probably damaging Het
Serping1 C T 2: 84,771,449 V226M probably damaging Het
Sf3b1 A T 1: 54,998,188 D856E possibly damaging Het
Sfmbt1 T A 14: 30,802,567 Y503N probably damaging Het
Slc16a1 T A 3: 104,653,564 V395D probably damaging Het
Slc22a7 A T 17: 46,438,231 D53E probably benign Het
Slc35b3 A G 13: 38,960,611 probably null Het
Slc6a1 T C 6: 114,311,854 M274T possibly damaging Het
Slco1a5 A G 6: 142,242,063 S517P probably benign Het
Smo A G 6: 29,736,056 R16G unknown Het
Srebf1 A G 11: 60,203,486 L601P probably damaging Het
Sspo A G 6: 48,459,350 I1086M probably benign Het
Tas2r106 A T 6: 131,678,410 N159K probably damaging Het
Thsd1 G A 8: 22,252,318 probably benign Het
Tmeff1 T C 4: 48,658,938 probably benign Het
Tmem140 G A 6: 34,872,903 C118Y possibly damaging Het
Tmem168 A G 6: 13,583,071 C220R probably benign Het
Tox2 A T 2: 163,276,167 N129Y probably damaging Het
Trappc12 C T 12: 28,746,985 E183K probably damaging Het
Unc50 A G 1: 37,438,799 Y254C probably damaging Het
Unk T G 11: 116,059,081 D691E probably benign Het
Uox T A 3: 146,610,379 V23D probably damaging Het
Vps13d A G 4: 145,126,606 C2313R probably benign Het
Zfp804b T A 5: 6,769,283 H1260L probably damaging Het
Zfyve26 A G 12: 79,264,351 L147P probably damaging Het
Zmynd10 A T 9: 107,550,037 Q288L probably benign Het
Zzef1 T A 11: 72,848,714 D662E probably damaging Het
Other mutations in Nox4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Nox4 APN 7 87376216 missense possibly damaging 0.89
IGL02711:Nox4 APN 7 87396868 missense probably damaging 1.00
IGL03234:Nox4 APN 7 87317313 critical splice donor site probably null
IGL03286:Nox4 APN 7 87370141 splice site probably benign
LCD18:Nox4 UTSW 7 87243067 unclassified probably benign
PIT4151001:Nox4 UTSW 7 87304889 missense probably benign 0.02
R0717:Nox4 UTSW 7 87304890 nonsense probably null
R1033:Nox4 UTSW 7 87374413 missense probably damaging 0.99
R1135:Nox4 UTSW 7 87323789 missense probably damaging 1.00
R1333:Nox4 UTSW 7 87246864 missense possibly damaging 0.80
R1477:Nox4 UTSW 7 87295866 missense probably benign 0.16
R1489:Nox4 UTSW 7 87304889 missense probably damaging 0.99
R1579:Nox4 UTSW 7 87370023 missense probably damaging 0.98
R1669:Nox4 UTSW 7 87295889 missense probably benign 0.01
R1742:Nox4 UTSW 7 87295818 missense possibly damaging 0.82
R2112:Nox4 UTSW 7 87372008 missense probably damaging 1.00
R2192:Nox4 UTSW 7 87374380 missense probably benign 0.02
R2496:Nox4 UTSW 7 87306750 missense probably benign 0.04
R2497:Nox4 UTSW 7 87295876 nonsense probably null
R4158:Nox4 UTSW 7 87396824 missense possibly damaging 0.95
R4160:Nox4 UTSW 7 87396824 missense possibly damaging 0.95
R4281:Nox4 UTSW 7 87297524 missense possibly damaging 0.77
R4685:Nox4 UTSW 7 87297508 missense probably benign 0.36
R4791:Nox4 UTSW 7 87304847 missense probably benign 0.35
R5001:Nox4 UTSW 7 87360803 missense probably damaging 0.96
R5091:Nox4 UTSW 7 87376242 missense probably damaging 1.00
R5174:Nox4 UTSW 7 87323766 missense probably benign 0.10
R5220:Nox4 UTSW 7 87374408 missense possibly damaging 0.91
R5278:Nox4 UTSW 7 87371926 missense probably damaging 1.00
R5723:Nox4 UTSW 7 87304973 intron probably benign
R5840:Nox4 UTSW 7 87360793 missense probably benign 0.00
R5852:Nox4 UTSW 7 87338964 missense probably damaging 0.98
X0021:Nox4 UTSW 7 87395678 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTGCCACATTACACAAGAG -3'
(R):5'- CCCCAGATCTAATTTGTAAAGAGTC -3'

Sequencing Primer
(F):5'- GTTGCCCAAATTAATAACACTGTAC -3'
(R):5'- CAGTCTAGGTTACTTGGGA -3'
Posted On2014-07-14