Incidental Mutation 'R1900:Polr2a'
ID214215
Institutional Source Beutler Lab
Gene Symbol Polr2a
Ensembl Gene ENSMUSG00000005198
Gene Namepolymerase (RNA) II (DNA directed) polypeptide A
SynonymsRpo2-1, 220kDa
MMRRC Submission 039920-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.991) question?
Stock #R1900 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location69733997-69758637 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69743946 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 636 (I636N)
Ref Sequence ENSEMBL: ENSMUSP00000071200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058470] [ENSMUST00000071213]
Predicted Effect probably damaging
Transcript: ENSMUST00000058470
AA Change: I636N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000050771
Gene: ENSMUSG00000005198
AA Change: I636N

DomainStartEndE-ValueType
Blast:RPOLA_N 110 179 5e-37 BLAST
RPOLA_N 246 549 7.02e-203 SMART
Pfam:RNA_pol_Rpb1_4 716 823 3.6e-39 PFAM
Pfam:RNA_pol_Rpb1_5 830 1428 2e-101 PFAM
Pfam:RNA_pol_Rpb1_6 896 1079 1.7e-70 PFAM
Pfam:RNA_pol_Rpb1_7 1164 1299 1.7e-57 PFAM
Pfam:RNA_pol_Rpb1_R 1555 1568 2.1e-3 PFAM
Pfam:RNA_pol_Rpb1_R 1616 1629 8.8e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1630 1643 1.9e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1644 1657 2.3e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1658 1671 2.2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1672 1685 2.4e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1686 1699 2.5e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1700 1713 2.5e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1714 1727 2.5e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1728 1741 2.6e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1742 1755 5.3e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1757 1769 5.8e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1784 1797 2.6e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1798 1811 4.8e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1826 1839 4.3e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1841 1853 2e-3 PFAM
Pfam:RNA_pol_Rpb1_R 1854 1867 6.9e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1868 1881 3.7e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1882 1895 1.2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1896 1909 5e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1910 1923 2.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1924 1936 2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1931 1954 2.6e-3 PFAM
Pfam:RNA_pol_Rpb1_R 1948 1960 2.5e-3 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000071213
AA Change: I636N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000071200
Gene: ENSMUSG00000005198
AA Change: I636N

DomainStartEndE-ValueType
Blast:RPOLA_N 110 179 5e-37 BLAST
RPOLA_N 246 549 7.02e-203 SMART
Pfam:RNA_pol_Rpb1_4 716 823 1.8e-41 PFAM
Pfam:RNA_pol_Rpb1_5 830 1428 4.8e-104 PFAM
Pfam:RNA_pol_Rpb1_6 896 1079 5.2e-74 PFAM
Pfam:RNA_pol_Rpb1_7 1164 1299 1.4e-55 PFAM
low complexity region 1503 1522 N/A INTRINSIC
low complexity region 1524 1549 N/A INTRINSIC
Pfam:RNA_pol_Rpb1_R 1578 1591 2.7e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1592 1605 2.5e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1606 1619 2.7e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1620 1633 2.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1634 1647 2.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1648 1661 2.4e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1662 1675 2.4e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1676 1689 2.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1690 1703 2.3e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1704 1717 5.2e-7 PFAM
Pfam:RNA_pol_Rpb1_R 1718 1731 5.5e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1732 1745 1.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1746 1759 8.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1760 1773 2e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1788 1801 3.3e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1802 1815 2.4e-4 PFAM
Pfam:RNA_pol_Rpb1_R 1816 1829 8.3e-7 PFAM
Pfam:RNA_pol_Rpb1_R 1830 1843 2.2e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1844 1857 1.6e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1858 1871 2.8e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1872 1885 6e-7 PFAM
Pfam:RNA_pol_Rpb1_R 1886 1899 4.6e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1893 1909 4.8e-5 PFAM
Pfam:RNA_pol_Rpb1_R 1903 1916 2.8e-6 PFAM
Pfam:RNA_pol_Rpb1_R 1910 1923 1.6e-4 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151586
Meta Mutation Damage Score 0.384 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 96% (100/104)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the largest subunit of RNA polymerase II, the polymerase responsible for synthesizing messenger RNA in eukaryotes. The product of this gene contains a carboxy terminal domain composed of heptapeptide repeats that are essential for polymerase activity. These repeats contain serine and threonine residues that are phosphorylated in actively transcribing RNA polymerase. In addition, this subunit, in combination with several other polymerase subunits, forms the DNA binding domain of the polymerase, a groove in which the DNA template is transcribed into RNA. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a reporter allele show prenatal lethality. Homozygotes for a small deletion in the C-terminal domain are viable, fertile and developmentally normal. Homozygotes for a larger deletion show reduced fetal size and partial postnatal lethality; survivors are small but otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,770,583 T478A probably damaging Het
6330409D20Rik T C 2: 32,740,547 probably benign Het
Ago4 T C 4: 126,516,936 I221V probably benign Het
Ankfy1 C T 11: 72,754,407 Q771* probably null Het
Ankrd50 T C 3: 38,455,387 T944A probably damaging Het
AU040320 A C 4: 126,853,280 probably null Het
Axdnd1 A G 1: 156,380,774 probably null Het
Cdadc1 A T 14: 59,586,532 D170E probably damaging Het
Cep164 C A 9: 45,809,825 R93L probably damaging Het
Cep250 T C 2: 155,985,374 probably null Het
Cfdp1 G A 8: 111,768,729 R286* probably null Het
Chrdl2 A G 7: 100,033,664 I377V possibly damaging Het
Cntrob A T 11: 69,308,054 S623T probably benign Het
Col6a5 C T 9: 105,931,213 G879S unknown Het
Cyp2c38 T A 19: 39,438,312 I182F probably benign Het
Dennd4a T C 9: 64,897,336 V1319A probably damaging Het
Dysf T G 6: 84,039,567 V70G probably damaging Het
Edn3 A G 2: 174,761,605 T49A possibly damaging Het
Elac1 C G 18: 73,739,245 L226F probably damaging Het
Eps8l3 A G 3: 107,890,952 D445G probably benign Het
Fam71a T A 1: 191,164,434 K4M possibly damaging Het
Fgf11 G T 11: 69,801,453 T58K probably benign Het
Fstl5 T A 3: 76,708,160 W843R probably damaging Het
Fyb2 A G 4: 104,945,455 R185G probably benign Het
Gal3st2c G A 1: 94,009,044 R237H probably damaging Het
Galnt15 G T 14: 32,049,865 R289L probably damaging Het
Gdf5 T A 2: 155,942,081 D317V probably damaging Het
Gm10436 A C 12: 88,177,260 L261R probably benign Het
Gm7808 A G 9: 19,928,114 probably benign Het
Hcn3 T C 3: 89,148,263 E559G probably benign Het
Hdlbp A T 1: 93,422,237 probably benign Het
Hhip T C 8: 79,975,046 T620A probably benign Het
Hs3st3a1 T C 11: 64,520,442 S269P probably damaging Het
Il17ra A T 6: 120,477,394 probably null Het
Kif2a T C 13: 106,976,995 N417S possibly damaging Het
Klhl41 T A 2: 69,674,619 probably benign Het
L3mbtl4 G T 17: 68,459,805 C169F probably damaging Het
Lap3 T C 5: 45,511,910 F467S probably damaging Het
Lpar6 A T 14: 73,239,139 Y180F probably benign Het
Lrig3 T C 10: 126,002,393 probably benign Het
Ltbp2 A T 12: 84,830,658 S378T probably damaging Het
Ltf T C 9: 111,022,845 F117L possibly damaging Het
Med16 T C 10: 79,898,931 E533G probably damaging Het
Meltf T C 16: 31,881,969 probably null Het
Mphosph10 C T 7: 64,381,028 E488K possibly damaging Het
Mroh1 A G 15: 76,433,385 T812A probably benign Het
Mto1 T C 9: 78,461,517 probably benign Het
Ndst1 A T 18: 60,712,721 probably null Het
Ndst4 T A 3: 125,697,895 probably null Het
Nhlh1 A T 1: 172,054,041 I86N probably damaging Het
Nme9 A C 9: 99,459,774 D59A probably damaging Het
Nox4 A T 7: 87,360,796 R402* probably null Het
Npr1 T C 3: 90,462,188 D410G probably damaging Het
Nrip1 T A 16: 76,292,039 T877S probably benign Het
Nsd2 A G 5: 33,846,169 N221S probably benign Het
Olfr1230 T C 2: 89,296,670 N200S probably damaging Het
Olfr1463 T A 19: 13,234,913 I221K possibly damaging Het
Olfr23 C A 11: 73,940,660 P138Q possibly damaging Het
Olfr250 A T 9: 38,368,064 I173L probably benign Het
Olfr561 A T 7: 102,775,331 H269L probably benign Het
Olfr61 A T 7: 140,638,592 D297V probably damaging Het
Olfr616 A T 7: 103,564,607 L224* probably null Het
Ophn1 A T X: 98,726,059 Y181* probably null Het
Parp1 A G 1: 180,597,339 K819R probably damaging Het
Parp9 T C 16: 35,972,221 S829P probably benign Het
Pde6c T A 19: 38,161,940 F511Y probably damaging Het
Per3 G T 4: 151,041,426 H145Q probably damaging Het
Pglyrp1 C T 7: 18,890,226 R145W probably damaging Het
Piezo1 T C 8: 122,482,645 probably benign Het
Plb1 T C 5: 32,286,847 I312T probably benign Het
Plin3 T A 17: 56,279,824 T408S possibly damaging Het
Prex2 G T 1: 11,162,366 E886* probably null Het
Proca1 A T 11: 78,205,021 I73F probably damaging Het
Prpmp5 A T 6: 132,314,698 L11Q unknown Het
Ptpn6 A G 6: 124,728,933 S83P probably benign Het
Rtp1 G T 16: 23,429,299 V41L probably benign Het
Scn4a A G 11: 106,327,533 I1035T probably damaging Het
Sell A T 1: 164,065,338 Y41F probably damaging Het
Serping1 C T 2: 84,771,449 V226M probably damaging Het
Sf3b1 A T 1: 54,998,188 D856E possibly damaging Het
Sfmbt1 T A 14: 30,802,567 Y503N probably damaging Het
Slc16a1 T A 3: 104,653,564 V395D probably damaging Het
Slc22a7 A T 17: 46,438,231 D53E probably benign Het
Slc35b3 A G 13: 38,960,611 probably null Het
Slc6a1 T C 6: 114,311,854 M274T possibly damaging Het
Slco1a5 A G 6: 142,242,063 S517P probably benign Het
Smo A G 6: 29,736,056 R16G unknown Het
Srebf1 A G 11: 60,203,486 L601P probably damaging Het
Sspo A G 6: 48,459,350 I1086M probably benign Het
Tas2r106 A T 6: 131,678,410 N159K probably damaging Het
Thsd1 G A 8: 22,252,318 probably benign Het
Tmeff1 T C 4: 48,658,938 probably benign Het
Tmem140 G A 6: 34,872,903 C118Y possibly damaging Het
Tmem168 A G 6: 13,583,071 C220R probably benign Het
Tox2 A T 2: 163,276,167 N129Y probably damaging Het
Trappc12 C T 12: 28,746,985 E183K probably damaging Het
Unc50 A G 1: 37,438,799 Y254C probably damaging Het
Unk T G 11: 116,059,081 D691E probably benign Het
Uox T A 3: 146,610,379 V23D probably damaging Het
Vps13d A G 4: 145,126,606 C2313R probably benign Het
Zfp804b T A 5: 6,769,283 H1260L probably damaging Het
Zfyve26 A G 12: 79,264,351 L147P probably damaging Het
Zmynd10 A T 9: 107,550,037 Q288L probably benign Het
Zzef1 T A 11: 72,848,714 D662E probably damaging Het
Other mutations in Polr2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Polr2a APN 11 69743794 splice site probably benign
IGL01067:Polr2a APN 11 69748014 missense possibly damaging 0.94
IGL01547:Polr2a APN 11 69744942 missense probably damaging 0.99
IGL01589:Polr2a APN 11 69741194 missense probably benign
IGL01955:Polr2a APN 11 69741848 missense probably damaging 1.00
IGL02457:Polr2a APN 11 69743250 splice site probably benign
IGL02526:Polr2a APN 11 69739467 missense probably benign 0.03
IGL02792:Polr2a APN 11 69746112 missense probably damaging 0.99
IGL03058:Polr2a APN 11 69745047 splice site probably null
IGL03083:Polr2a APN 11 69745046 critical splice acceptor site probably null
IGL03198:Polr2a APN 11 69747281 splice site probably null
IGL03201:Polr2a APN 11 69745690 nonsense probably null
PIT4260001:Polr2a UTSW 11 69735967 missense possibly damaging 0.93
R0126:Polr2a UTSW 11 69747425 missense probably damaging 0.99
R0254:Polr2a UTSW 11 69743671 missense possibly damaging 0.75
R0313:Polr2a UTSW 11 69735080 missense unknown
R0336:Polr2a UTSW 11 69736893 missense possibly damaging 0.92
R0453:Polr2a UTSW 11 69741019 missense possibly damaging 0.65
R0762:Polr2a UTSW 11 69735117 missense unknown
R1101:Polr2a UTSW 11 69748071 missense probably benign 0.23
R1509:Polr2a UTSW 11 69747213 missense possibly damaging 0.93
R1547:Polr2a UTSW 11 69734555 missense probably benign 0.39
R1567:Polr2a UTSW 11 69746031 missense probably benign 0.07
R1597:Polr2a UTSW 11 69739929 missense possibly damaging 0.88
R1614:Polr2a UTSW 11 69743373 missense possibly damaging 0.75
R1698:Polr2a UTSW 11 69739877 critical splice donor site probably null
R1735:Polr2a UTSW 11 69742396 missense probably damaging 0.99
R1743:Polr2a UTSW 11 69739503 missense probably damaging 0.96
R1899:Polr2a UTSW 11 69743946 missense probably damaging 0.99
R1931:Polr2a UTSW 11 69735375 missense unknown
R2217:Polr2a UTSW 11 69742685 critical splice donor site probably null
R2218:Polr2a UTSW 11 69742685 critical splice donor site probably null
R2245:Polr2a UTSW 11 69735183 missense unknown
R3123:Polr2a UTSW 11 69735710 missense possibly damaging 0.92
R3124:Polr2a UTSW 11 69735710 missense possibly damaging 0.92
R4018:Polr2a UTSW 11 69735059 missense unknown
R4025:Polr2a UTSW 11 69743659 missense possibly damaging 0.95
R4197:Polr2a UTSW 11 69735336 missense unknown
R4462:Polr2a UTSW 11 69746403 missense probably damaging 1.00
R4508:Polr2a UTSW 11 69742559 critical splice acceptor site probably null
R4746:Polr2a UTSW 11 69735674 missense probably benign 0.05
R5069:Polr2a UTSW 11 69736735 intron probably null
R5102:Polr2a UTSW 11 69746945 missense possibly damaging 0.93
R5195:Polr2a UTSW 11 69744079 missense probably damaging 1.00
R5234:Polr2a UTSW 11 69736840 missense probably benign 0.03
R5330:Polr2a UTSW 11 69747275 missense probably benign 0.01
R5331:Polr2a UTSW 11 69747275 missense probably benign 0.01
R5896:Polr2a UTSW 11 69736260 missense probably damaging 0.99
R5910:Polr2a UTSW 11 69746870 missense probably damaging 0.99
R6128:Polr2a UTSW 11 69736977 missense probably damaging 1.00
R6238:Polr2a UTSW 11 69747221 missense possibly damaging 0.95
R6244:Polr2a UTSW 11 69744226 missense probably damaging 1.00
R6303:Polr2a UTSW 11 69746913 missense probably damaging 1.00
R6338:Polr2a UTSW 11 69739679 intron probably null
R6361:Polr2a UTSW 11 69743337 missense probably damaging 0.99
R6374:Polr2a UTSW 11 69736932 missense probably damaging 0.98
R6630:Polr2a UTSW 11 69735513 missense possibly damaging 0.93
R6631:Polr2a UTSW 11 69735513 missense possibly damaging 0.93
R6633:Polr2a UTSW 11 69735513 missense possibly damaging 0.93
R6897:Polr2a UTSW 11 69735961 missense probably benign 0.12
R6923:Polr2a UTSW 11 69735961 missense probably benign 0.12
R6933:Polr2a UTSW 11 69736177 missense probably damaging 0.99
R6933:Polr2a UTSW 11 69739467 missense probably benign 0.03
R6953:Polr2a UTSW 11 69741711 missense probably damaging 0.99
R6974:Polr2a UTSW 11 69747200 missense probably damaging 0.98
R7033:Polr2a UTSW 11 69747213 missense possibly damaging 0.93
R7085:Polr2a UTSW 11 69743880 missense probably damaging 0.99
R7112:Polr2a UTSW 11 69735309 missense unknown
R7124:Polr2a UTSW 11 69737462 nonsense probably null
R7319:Polr2a UTSW 11 69746370 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGAGGATTTGGAAGCTGGCTATAC -3'
(R):5'- GACAGGCAAGCAGATCTTCTC -3'

Sequencing Primer
(F):5'- ATTTGGAAGCTGGCTATACTGACCC -3'
(R):5'- TCAATTGTATCCGTACCCACAG -3'
Posted On2014-07-14