Incidental Mutation 'R1900:L3mbtl4'
ID214242
Institutional Source Beutler Lab
Gene Symbol L3mbtl4
Ensembl Gene ENSMUSG00000041565
Gene NameL3MBTL4 histone methyl-lysine binding protein
Synonyms
MMRRC Submission 039920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.049) question?
Stock #R1900 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location68273797-68777961 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 68459805 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 169 (C169F)
Ref Sequence ENSEMBL: ENSMUSP00000094892 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093007] [ENSMUST00000124543] [ENSMUST00000139383]
Predicted Effect probably damaging
Transcript: ENSMUST00000093007
AA Change: C169F

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000094892
Gene: ENSMUSG00000041565
AA Change: C169F

DomainStartEndE-ValueType
MBT 52 152 2.24e-46 SMART
MBT 160 260 6.29e-41 SMART
MBT 269 364 2.8e-47 SMART
Pfam:zf-C2HC 378 407 8.1e-16 PFAM
SAM 540 607 5.17e-11 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000124543
AA Change: C169F

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000121045
Gene: ENSMUSG00000041565
AA Change: C169F

DomainStartEndE-ValueType
MBT 52 152 2.24e-46 SMART
MBT 160 260 6.29e-41 SMART
MBT 269 364 2.8e-47 SMART
Pfam:zf-C2HC 376 407 3.3e-15 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000139383
AA Change: C169F

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117626
Gene: ENSMUSG00000041565
AA Change: C169F

DomainStartEndE-ValueType
MBT 52 152 2.24e-46 SMART
MBT 160 260 6.29e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150573
Meta Mutation Damage Score 0.244 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.0%
Validation Efficiency 96% (100/104)
Allele List at MGI
Other mutations in this stock
Total: 104 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik T C 14: 49,770,583 T478A probably damaging Het
6330409D20Rik T C 2: 32,740,547 probably benign Het
Ago4 T C 4: 126,516,936 I221V probably benign Het
Ankfy1 C T 11: 72,754,407 Q771* probably null Het
Ankrd50 T C 3: 38,455,387 T944A probably damaging Het
AU040320 A C 4: 126,853,280 probably null Het
Axdnd1 A G 1: 156,380,774 probably null Het
Cdadc1 A T 14: 59,586,532 D170E probably damaging Het
Cep164 C A 9: 45,809,825 R93L probably damaging Het
Cep250 T C 2: 155,985,374 probably null Het
Cfdp1 G A 8: 111,768,729 R286* probably null Het
Chrdl2 A G 7: 100,033,664 I377V possibly damaging Het
Cntrob A T 11: 69,308,054 S623T probably benign Het
Col6a5 C T 9: 105,931,213 G879S unknown Het
Cyp2c38 T A 19: 39,438,312 I182F probably benign Het
Dennd4a T C 9: 64,897,336 V1319A probably damaging Het
Dysf T G 6: 84,039,567 V70G probably damaging Het
Edn3 A G 2: 174,761,605 T49A possibly damaging Het
Elac1 C G 18: 73,739,245 L226F probably damaging Het
Eps8l3 A G 3: 107,890,952 D445G probably benign Het
Fam71a T A 1: 191,164,434 K4M possibly damaging Het
Fgf11 G T 11: 69,801,453 T58K probably benign Het
Fstl5 T A 3: 76,708,160 W843R probably damaging Het
Fyb2 A G 4: 104,945,455 R185G probably benign Het
Gal3st2c G A 1: 94,009,044 R237H probably damaging Het
Galnt15 G T 14: 32,049,865 R289L probably damaging Het
Gdf5 T A 2: 155,942,081 D317V probably damaging Het
Gm10436 A C 12: 88,177,260 L261R probably benign Het
Gm7808 A G 9: 19,928,114 probably benign Het
Hcn3 T C 3: 89,148,263 E559G probably benign Het
Hdlbp A T 1: 93,422,237 probably benign Het
Hhip T C 8: 79,975,046 T620A probably benign Het
Hs3st3a1 T C 11: 64,520,442 S269P probably damaging Het
Il17ra A T 6: 120,477,394 probably null Het
Kif2a T C 13: 106,976,995 N417S possibly damaging Het
Klhl41 T A 2: 69,674,619 probably benign Het
Lap3 T C 5: 45,511,910 F467S probably damaging Het
Lpar6 A T 14: 73,239,139 Y180F probably benign Het
Lrig3 T C 10: 126,002,393 probably benign Het
Ltbp2 A T 12: 84,830,658 S378T probably damaging Het
Ltf T C 9: 111,022,845 F117L possibly damaging Het
Med16 T C 10: 79,898,931 E533G probably damaging Het
Meltf T C 16: 31,881,969 probably null Het
Mphosph10 C T 7: 64,381,028 E488K possibly damaging Het
Mroh1 A G 15: 76,433,385 T812A probably benign Het
Mto1 T C 9: 78,461,517 probably benign Het
Ndst1 A T 18: 60,712,721 probably null Het
Ndst4 T A 3: 125,697,895 probably null Het
Nhlh1 A T 1: 172,054,041 I86N probably damaging Het
Nme9 A C 9: 99,459,774 D59A probably damaging Het
Nox4 A T 7: 87,360,796 R402* probably null Het
Npr1 T C 3: 90,462,188 D410G probably damaging Het
Nrip1 T A 16: 76,292,039 T877S probably benign Het
Nsd2 A G 5: 33,846,169 N221S probably benign Het
Olfr1230 T C 2: 89,296,670 N200S probably damaging Het
Olfr1463 T A 19: 13,234,913 I221K possibly damaging Het
Olfr23 C A 11: 73,940,660 P138Q possibly damaging Het
Olfr250 A T 9: 38,368,064 I173L probably benign Het
Olfr561 A T 7: 102,775,331 H269L probably benign Het
Olfr61 A T 7: 140,638,592 D297V probably damaging Het
Olfr616 A T 7: 103,564,607 L224* probably null Het
Ophn1 A T X: 98,726,059 Y181* probably null Het
Parp1 A G 1: 180,597,339 K819R probably damaging Het
Parp9 T C 16: 35,972,221 S829P probably benign Het
Pde6c T A 19: 38,161,940 F511Y probably damaging Het
Per3 G T 4: 151,041,426 H145Q probably damaging Het
Pglyrp1 C T 7: 18,890,226 R145W probably damaging Het
Piezo1 T C 8: 122,482,645 probably benign Het
Plb1 T C 5: 32,286,847 I312T probably benign Het
Plin3 T A 17: 56,279,824 T408S possibly damaging Het
Polr2a A T 11: 69,743,946 I636N probably damaging Het
Prex2 G T 1: 11,162,366 E886* probably null Het
Proca1 A T 11: 78,205,021 I73F probably damaging Het
Prpmp5 A T 6: 132,314,698 L11Q unknown Het
Ptpn6 A G 6: 124,728,933 S83P probably benign Het
Rtp1 G T 16: 23,429,299 V41L probably benign Het
Scn4a A G 11: 106,327,533 I1035T probably damaging Het
Sell A T 1: 164,065,338 Y41F probably damaging Het
Serping1 C T 2: 84,771,449 V226M probably damaging Het
Sf3b1 A T 1: 54,998,188 D856E possibly damaging Het
Sfmbt1 T A 14: 30,802,567 Y503N probably damaging Het
Slc16a1 T A 3: 104,653,564 V395D probably damaging Het
Slc22a7 A T 17: 46,438,231 D53E probably benign Het
Slc35b3 A G 13: 38,960,611 probably null Het
Slc6a1 T C 6: 114,311,854 M274T possibly damaging Het
Slco1a5 A G 6: 142,242,063 S517P probably benign Het
Smo A G 6: 29,736,056 R16G unknown Het
Srebf1 A G 11: 60,203,486 L601P probably damaging Het
Sspo A G 6: 48,459,350 I1086M probably benign Het
Tas2r106 A T 6: 131,678,410 N159K probably damaging Het
Thsd1 G A 8: 22,252,318 probably benign Het
Tmeff1 T C 4: 48,658,938 probably benign Het
Tmem140 G A 6: 34,872,903 C118Y possibly damaging Het
Tmem168 A G 6: 13,583,071 C220R probably benign Het
Tox2 A T 2: 163,276,167 N129Y probably damaging Het
Trappc12 C T 12: 28,746,985 E183K probably damaging Het
Unc50 A G 1: 37,438,799 Y254C probably damaging Het
Unk T G 11: 116,059,081 D691E probably benign Het
Uox T A 3: 146,610,379 V23D probably damaging Het
Vps13d A G 4: 145,126,606 C2313R probably benign Het
Zfp804b T A 5: 6,769,283 H1260L probably damaging Het
Zfyve26 A G 12: 79,264,351 L147P probably damaging Het
Zmynd10 A T 9: 107,550,037 Q288L probably benign Het
Zzef1 T A 11: 72,848,714 D662E probably damaging Het
Other mutations in L3mbtl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:L3mbtl4 APN 17 68630202 missense probably damaging 1.00
IGL02274:L3mbtl4 APN 17 68764584 missense probably benign 0.01
IGL02304:L3mbtl4 APN 17 68587185 nonsense probably null
IGL02473:L3mbtl4 APN 17 68559777 missense possibly damaging 0.93
IGL02543:L3mbtl4 APN 17 68461612 splice site probably benign
IGL02706:L3mbtl4 APN 17 68486919 missense probably damaging 1.00
IGL02729:L3mbtl4 APN 17 68484743 missense probably benign 0.23
IGL02817:L3mbtl4 APN 17 68630254 missense probably benign 0.30
IGL03237:L3mbtl4 APN 17 68777861 missense probably damaging 1.00
IGL03371:L3mbtl4 APN 17 68461568 missense probably damaging 1.00
R0092:L3mbtl4 UTSW 17 68425703 missense probably benign 0.01
R0389:L3mbtl4 UTSW 17 68455780 missense probably damaging 1.00
R0504:L3mbtl4 UTSW 17 68777912 missense probably benign 0.07
R0598:L3mbtl4 UTSW 17 68459773 missense probably benign 0.04
R0650:L3mbtl4 UTSW 17 68774291 missense probably damaging 1.00
R0652:L3mbtl4 UTSW 17 68774291 missense probably damaging 1.00
R0842:L3mbtl4 UTSW 17 68486962 missense probably benign 0.19
R2065:L3mbtl4 UTSW 17 68425692 missense probably benign 0.04
R2173:L3mbtl4 UTSW 17 68587193 missense probably damaging 1.00
R2987:L3mbtl4 UTSW 17 68359518 missense possibly damaging 0.89
R3119:L3mbtl4 UTSW 17 68425674 missense probably benign 0.02
R3153:L3mbtl4 UTSW 17 68457248 nonsense probably null
R4044:L3mbtl4 UTSW 17 68777914 missense possibly damaging 0.63
R4579:L3mbtl4 UTSW 17 68764640 missense probably benign
R4717:L3mbtl4 UTSW 17 68455713 missense probably null 0.67
R4798:L3mbtl4 UTSW 17 68359480 start codon destroyed probably null 0.03
R4831:L3mbtl4 UTSW 17 68461563 missense probably damaging 0.98
R4852:L3mbtl4 UTSW 17 68559753 missense probably damaging 1.00
R5226:L3mbtl4 UTSW 17 68764722 critical splice donor site probably null
R5402:L3mbtl4 UTSW 17 68455774 missense probably damaging 1.00
R5604:L3mbtl4 UTSW 17 68777922 missense probably benign 0.01
R6377:L3mbtl4 UTSW 17 68777923 missense probably benign 0.04
R6708:L3mbtl4 UTSW 17 68630258 missense probably benign 0.19
R6853:L3mbtl4 UTSW 17 68777920 missense probably damaging 0.97
R6905:L3mbtl4 UTSW 17 68777888 missense probably benign 0.05
X0063:L3mbtl4 UTSW 17 68630253 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TCTGTGAAGAGTGACATACTGTG -3'
(R):5'- AGAAAACTCACTTGCTGCAAGC -3'

Sequencing Primer
(F):5'- AACACAACAACTTTTAACTTAAGGC -3'
(R):5'- TCTGAAGTATCTAATTGCAATGCTG -3'
Posted On2014-07-14