Incidental Mutation 'R1905:Pikfyve'
ID 214252
Institutional Source Beutler Lab
Gene Symbol Pikfyve
Ensembl Gene ENSMUSG00000025949
Gene Name phosphoinositide kinase, FYVE type zinc finger containing
Synonyms PipkIII, Pip5k3, 5230400C17Rik
MMRRC Submission 039924-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1905 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 65225842-65317854 bp(+) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 65231454 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000095314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000081154] [ENSMUST00000097707] [ENSMUST00000185263] [ENSMUST00000190058]
AlphaFold Q9Z1T6
Predicted Effect probably null
Transcript: ENSMUST00000081154
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably null
Transcript: ENSMUST00000081154
SMART Domains Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 161 230 5.95e-18 SMART
DEP 376 451 9.05e-27 SMART
Pfam:Cpn60_TCP1 547 822 2e-37 PFAM
low complexity region 1177 1189 N/A INTRINSIC
low complexity region 1516 1536 N/A INTRINSIC
PIPKc 1745 2039 3.03e-162 SMART
Predicted Effect probably null
Transcript: ENSMUST00000097707
SMART Domains Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
FYVE 150 219 5.95e-18 SMART
DEP 365 440 9.05e-27 SMART
Pfam:Cpn60_TCP1 590 864 1.8e-35 PFAM
low complexity region 1222 1234 N/A INTRINSIC
low complexity region 1561 1581 N/A INTRINSIC
PIPKc 1790 2084 3.03e-162 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185263
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186404
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187579
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188799
Predicted Effect probably benign
Transcript: ENSMUST00000190058
SMART Domains Protein: ENSMUSP00000140204
Gene: ENSMUSG00000025949

DomainStartEndE-ValueType
low complexity region 58 81 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189925
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190847
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 97.5%
  • 3x: 97.0%
  • 10x: 95.5%
  • 20x: 93.1%
Validation Efficiency 99% (90/91)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]
Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833420G17Rik G T 13: 119,606,216 (GRCm39) V153L possibly damaging Het
Adamts17 T A 7: 66,697,220 (GRCm39) C631* probably null Het
Adamts19 A G 18: 59,166,017 (GRCm39) R1070G possibly damaging Het
Aldh1a1 A G 19: 20,595,362 (GRCm39) E97G probably damaging Het
Bola2 T A 7: 126,295,410 (GRCm39) V40E probably damaging Het
Ccar1 A G 10: 62,612,437 (GRCm39) S243P possibly damaging Het
Cd80 A T 16: 38,294,539 (GRCm39) I141F probably damaging Het
Ceacam23 T A 7: 17,607,477 (GRCm39) noncoding transcript Het
Chn2 T C 6: 54,263,106 (GRCm39) C92R probably damaging Het
Ciao2a A G 9: 66,039,929 (GRCm39) K82R probably benign Het
Clk1 A T 1: 58,461,101 (GRCm39) probably benign Het
Clock T C 5: 76,414,735 (GRCm39) probably benign Het
Cntnap3 A G 13: 65,051,578 (GRCm39) V26A probably benign Het
Csf3r A T 4: 125,936,538 (GRCm39) K651N probably benign Het
Cul4a T C 8: 13,183,171 (GRCm39) M322T probably benign Het
Cx3cl1 A G 8: 95,506,687 (GRCm39) T231A probably benign Het
Cyp2c68 A T 19: 39,724,026 (GRCm39) C213S probably benign Het
Dhx16 T G 17: 36,199,247 (GRCm39) S814A probably benign Het
Dnah1 T C 14: 30,986,587 (GRCm39) I3659V probably benign Het
Dock6 A T 9: 21,740,870 (GRCm39) V906D probably benign Het
Ep400 G A 5: 110,818,814 (GRCm39) T2738I probably damaging Het
Erbb4 A T 1: 68,114,569 (GRCm39) probably benign Het
Fam135b C T 15: 71,404,836 (GRCm39) R70H probably damaging Het
Fam13a T C 6: 58,930,475 (GRCm39) Q479R probably damaging Het
Fcgr4 A T 1: 170,856,874 (GRCm39) Q247L probably damaging Het
Flnc T A 6: 29,459,459 (GRCm39) C2520S probably damaging Het
Foxn1 A G 11: 78,262,636 (GRCm39) probably null Het
Fsip2 C T 2: 82,813,772 (GRCm39) P3364S possibly damaging Het
Fzd8 C T 18: 9,213,803 (GRCm39) T295I probably damaging Het
Gm4744 G A 6: 40,928,736 (GRCm39) probably benign Het
Gm4871 G T 5: 144,966,859 (GRCm39) A208D probably damaging Het
Gm527 A G 12: 64,967,797 (GRCm39) N73S possibly damaging Het
Gm5414 T C 15: 101,533,075 (GRCm39) I451V probably damaging Het
Golm1 A T 13: 59,790,065 (GRCm39) V245E probably benign Het
Grik1 A T 16: 87,693,754 (GRCm39) Y879* probably null Het
Grn C A 11: 102,327,276 (GRCm39) P241Q probably damaging Het
H2-T7 T C 17: 36,453,833 (GRCm39) noncoding transcript Het
Hjurp T C 1: 88,194,338 (GRCm39) E190G probably benign Het
Hmcn1 A C 1: 150,868,606 (GRCm39) I66S probably damaging Het
Hykk T A 9: 54,853,667 (GRCm39) Y330N probably benign Het
Khdc1c A G 1: 21,439,281 (GRCm39) N89S probably benign Het
Lcor A G 19: 41,572,013 (GRCm39) D256G possibly damaging Het
Lrrc72 T A 12: 36,258,661 (GRCm39) probably null Het
Lyst T G 13: 13,808,719 (GRCm39) S130A probably benign Het
Mast1 G A 8: 85,642,895 (GRCm39) R967C probably damaging Het
Mfng T C 15: 78,657,286 (GRCm39) T63A probably damaging Het
Mre11a G A 9: 14,710,923 (GRCm39) D206N probably benign Het
Myh10 A G 11: 68,662,694 (GRCm39) probably benign Het
Myt1 A G 2: 181,439,549 (GRCm39) D357G probably damaging Het
Nacad T A 11: 6,552,540 (GRCm39) H217L probably benign Het
Ncoa1 A G 12: 4,345,433 (GRCm39) V638A probably damaging Het
Nlrp3 T G 11: 59,439,862 (GRCm39) F480V probably damaging Het
Nos1ap A G 1: 170,146,127 (GRCm39) W476R possibly damaging Het
Nr1h4 T A 10: 89,316,421 (GRCm39) T220S possibly damaging Het
Ntf5 G T 7: 45,065,176 (GRCm39) V103L probably damaging Het
Ntm C A 9: 29,090,393 (GRCm39) D109Y probably damaging Het
Or7e178 C T 9: 20,226,142 (GRCm39) E17K probably benign Het
P2rx7 G A 5: 122,819,015 (GRCm39) C479Y probably damaging Het
Pappa2 T A 1: 158,631,073 (GRCm39) probably null Het
Pgap1 A C 1: 54,551,120 (GRCm39) I520R probably benign Het
Plekhg3 T C 12: 76,622,991 (GRCm39) S744P probably benign Het
Pramel6 A G 2: 87,339,526 (GRCm39) R97G probably damaging Het
Pramel6 G T 2: 87,339,527 (GRCm39) R97M probably damaging Het
Psme4 T C 11: 30,760,922 (GRCm39) V397A probably damaging Het
Ptk2b T C 14: 66,396,119 (GRCm39) D783G probably damaging Het
Ptma-ps1 T A 7: 23,763,306 (GRCm39) L17* probably null Het
Ralgapa2 C A 2: 146,229,621 (GRCm39) R1053L probably damaging Het
Sap130 C T 18: 31,813,620 (GRCm39) P559L possibly damaging Het
Sap30 T C 8: 57,940,345 (GRCm39) S86G probably damaging Het
Sdk2 C T 11: 113,729,472 (GRCm39) silent Het
Sema3f G T 9: 107,561,575 (GRCm39) Q500K probably damaging Het
Serpinb3d T C 1: 107,007,014 (GRCm39) I231M possibly damaging Het
Sf3a1 T A 11: 4,126,678 (GRCm39) N563K probably benign Het
Sipa1l3 A G 7: 29,038,592 (GRCm39) S352P possibly damaging Het
Slc6a12 G T 6: 121,324,402 (GRCm39) E9* probably null Het
Srebf1 T C 11: 60,095,319 (GRCm39) D400G probably damaging Het
Swsap1 T C 9: 21,867,988 (GRCm39) Y87H probably damaging Het
Tanc2 G A 11: 105,813,689 (GRCm39) G1711D possibly damaging Het
Tas2r107 T C 6: 131,636,951 (GRCm39) M33V probably benign Het
Tdrd9 T A 12: 112,030,061 (GRCm39) probably benign Het
Tdrp T C 8: 14,004,079 (GRCm39) D86G probably damaging Het
Tmem92 A T 11: 94,669,501 (GRCm39) M106K probably benign Het
Tmf1 A T 6: 97,138,440 (GRCm39) C764S possibly damaging Het
Ttc21a G T 9: 119,795,823 (GRCm39) R1219L possibly damaging Het
Ttn C T 2: 76,593,792 (GRCm39) G18870D probably damaging Het
Tubgcp6 T C 15: 88,984,811 (GRCm39) Y1732C probably damaging Het
Vmn1r28 A G 6: 58,242,912 (GRCm39) T252A probably benign Het
Xirp2 A G 2: 67,346,700 (GRCm39) I2980M probably damaging Het
Zc2hc1c A G 12: 85,337,288 (GRCm39) D315G probably benign Het
Other mutations in Pikfyve
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Pikfyve APN 1 65,299,280 (GRCm39) critical splice donor site probably null
IGL01135:Pikfyve APN 1 65,290,794 (GRCm39) missense probably damaging 0.96
IGL01511:Pikfyve APN 1 65,298,028 (GRCm39) nonsense probably null
IGL01759:Pikfyve APN 1 65,292,512 (GRCm39) missense probably benign 0.06
IGL01888:Pikfyve APN 1 65,262,799 (GRCm39) missense probably damaging 1.00
IGL01967:Pikfyve APN 1 65,303,524 (GRCm39) missense possibly damaging 0.89
IGL02055:Pikfyve APN 1 65,277,703 (GRCm39) critical splice donor site probably null
IGL02119:Pikfyve APN 1 65,311,730 (GRCm39) missense probably damaging 1.00
IGL02141:Pikfyve APN 1 65,285,556 (GRCm39) missense probably benign 0.13
IGL02207:Pikfyve APN 1 65,290,837 (GRCm39) critical splice donor site probably null
IGL02380:Pikfyve APN 1 65,295,180 (GRCm39) missense probably damaging 0.99
IGL02400:Pikfyve APN 1 65,291,728 (GRCm39) missense probably damaging 1.00
IGL02403:Pikfyve APN 1 65,283,663 (GRCm39) missense probably damaging 0.99
IGL02426:Pikfyve APN 1 65,290,771 (GRCm39) missense possibly damaging 0.77
IGL02496:Pikfyve APN 1 65,303,535 (GRCm39) missense possibly damaging 0.94
IGL02573:Pikfyve APN 1 65,270,014 (GRCm39) critical splice donor site probably null
IGL02746:Pikfyve APN 1 65,273,431 (GRCm39) missense probably damaging 1.00
IGL02814:Pikfyve APN 1 65,289,353 (GRCm39) nonsense probably null
IGL02890:Pikfyve APN 1 65,269,956 (GRCm39) missense probably benign 0.00
IGL03102:Pikfyve APN 1 65,291,626 (GRCm39) nonsense probably null
IGL03294:Pikfyve APN 1 65,286,226 (GRCm39) missense probably damaging 1.00
falcon UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
oompa UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
wonka UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
G5538:Pikfyve UTSW 1 65,242,075 (GRCm39) missense probably damaging 1.00
R0031:Pikfyve UTSW 1 65,255,088 (GRCm39) splice site probably benign
R0196:Pikfyve UTSW 1 65,295,231 (GRCm39) missense possibly damaging 0.92
R0212:Pikfyve UTSW 1 65,302,064 (GRCm39) missense probably benign 0.41
R0319:Pikfyve UTSW 1 65,285,490 (GRCm39) missense probably benign 0.01
R0332:Pikfyve UTSW 1 65,303,558 (GRCm39) missense probably benign 0.02
R0389:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0443:Pikfyve UTSW 1 65,235,865 (GRCm39) missense probably damaging 1.00
R0503:Pikfyve UTSW 1 65,259,058 (GRCm39) missense probably damaging 0.97
R0722:Pikfyve UTSW 1 65,292,682 (GRCm39) missense probably damaging 0.99
R0906:Pikfyve UTSW 1 65,292,556 (GRCm39) missense probably damaging 1.00
R0907:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R0970:Pikfyve UTSW 1 65,304,983 (GRCm39) missense probably damaging 0.99
R1188:Pikfyve UTSW 1 65,286,118 (GRCm39) missense possibly damaging 0.46
R1412:Pikfyve UTSW 1 65,241,989 (GRCm39) missense possibly damaging 0.64
R1421:Pikfyve UTSW 1 65,310,470 (GRCm39) missense probably damaging 1.00
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1468:Pikfyve UTSW 1 65,290,825 (GRCm39) missense probably damaging 0.98
R1472:Pikfyve UTSW 1 65,263,360 (GRCm39) missense probably damaging 0.96
R1478:Pikfyve UTSW 1 65,302,136 (GRCm39) critical splice donor site probably null
R1501:Pikfyve UTSW 1 65,304,443 (GRCm39) missense possibly damaging 0.84
R1757:Pikfyve UTSW 1 65,291,707 (GRCm39) missense probably damaging 0.99
R1773:Pikfyve UTSW 1 65,285,529 (GRCm39) missense probably benign
R1773:Pikfyve UTSW 1 65,231,430 (GRCm39) missense probably damaging 0.99
R1795:Pikfyve UTSW 1 65,291,716 (GRCm39) missense probably damaging 1.00
R1855:Pikfyve UTSW 1 65,297,957 (GRCm39) missense probably benign 0.03
R1995:Pikfyve UTSW 1 65,285,867 (GRCm39) missense probably damaging 1.00
R2034:Pikfyve UTSW 1 65,261,516 (GRCm39) missense probably damaging 1.00
R2045:Pikfyve UTSW 1 65,292,512 (GRCm39) missense probably benign 0.06
R2229:Pikfyve UTSW 1 65,307,014 (GRCm39) missense probably damaging 1.00
R2295:Pikfyve UTSW 1 65,285,835 (GRCm39) missense probably damaging 0.99
R2913:Pikfyve UTSW 1 65,292,676 (GRCm39) missense probably damaging 1.00
R3818:Pikfyve UTSW 1 65,284,917 (GRCm39) missense probably damaging 1.00
R3832:Pikfyve UTSW 1 65,283,579 (GRCm39) missense probably damaging 0.99
R3850:Pikfyve UTSW 1 65,270,004 (GRCm39) missense probably damaging 1.00
R3946:Pikfyve UTSW 1 65,235,840 (GRCm39) missense probably damaging 1.00
R4105:Pikfyve UTSW 1 65,229,679 (GRCm39) unclassified probably benign
R4542:Pikfyve UTSW 1 65,283,589 (GRCm39) missense probably damaging 1.00
R4574:Pikfyve UTSW 1 65,231,351 (GRCm39) missense probably damaging 1.00
R4601:Pikfyve UTSW 1 65,273,421 (GRCm39) missense probably damaging 1.00
R4667:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4668:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4669:Pikfyve UTSW 1 65,289,432 (GRCm39) missense probably damaging 1.00
R4707:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4716:Pikfyve UTSW 1 65,285,635 (GRCm39) missense possibly damaging 0.84
R4758:Pikfyve UTSW 1 65,311,674 (GRCm39) missense possibly damaging 0.84
R4784:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4785:Pikfyve UTSW 1 65,307,005 (GRCm39) missense probably benign
R4805:Pikfyve UTSW 1 65,307,959 (GRCm39) missense probably damaging 0.99
R4831:Pikfyve UTSW 1 65,235,900 (GRCm39) missense probably damaging 1.00
R4837:Pikfyve UTSW 1 65,285,749 (GRCm39) missense possibly damaging 0.92
R5064:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5115:Pikfyve UTSW 1 65,263,276 (GRCm39) intron probably benign
R5265:Pikfyve UTSW 1 65,306,988 (GRCm39) missense possibly damaging 0.72
R5279:Pikfyve UTSW 1 65,235,858 (GRCm39) nonsense probably null
R5384:Pikfyve UTSW 1 65,283,568 (GRCm39) missense probably damaging 1.00
R5387:Pikfyve UTSW 1 65,304,427 (GRCm39) missense possibly damaging 0.94
R5461:Pikfyve UTSW 1 65,274,192 (GRCm39) missense probably damaging 1.00
R5467:Pikfyve UTSW 1 65,291,654 (GRCm39) missense probably damaging 1.00
R5560:Pikfyve UTSW 1 65,292,566 (GRCm39) missense probably damaging 1.00
R5575:Pikfyve UTSW 1 65,312,889 (GRCm39) missense probably damaging 1.00
R5611:Pikfyve UTSW 1 65,295,247 (GRCm39) missense probably damaging 0.96
R5663:Pikfyve UTSW 1 65,255,187 (GRCm39) missense probably benign 0.09
R5891:Pikfyve UTSW 1 65,241,896 (GRCm39) missense probably damaging 1.00
R5960:Pikfyve UTSW 1 65,292,597 (GRCm39) nonsense probably null
R6026:Pikfyve UTSW 1 65,311,856 (GRCm39) missense probably damaging 1.00
R6057:Pikfyve UTSW 1 65,311,730 (GRCm39) missense probably damaging 1.00
R6101:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6105:Pikfyve UTSW 1 65,303,504 (GRCm39) critical splice acceptor site probably null
R6161:Pikfyve UTSW 1 65,255,202 (GRCm39) missense probably benign 0.36
R6287:Pikfyve UTSW 1 65,292,691 (GRCm39) critical splice donor site probably null
R6290:Pikfyve UTSW 1 65,242,084 (GRCm39) critical splice donor site probably null
R6296:Pikfyve UTSW 1 65,302,112 (GRCm39) missense probably damaging 0.99
R6516:Pikfyve UTSW 1 65,304,940 (GRCm39) missense probably benign 0.35
R6835:Pikfyve UTSW 1 65,298,002 (GRCm39) missense probably damaging 0.98
R6994:Pikfyve UTSW 1 65,291,689 (GRCm39) missense probably damaging 1.00
R6997:Pikfyve UTSW 1 65,285,822 (GRCm39) missense probably damaging 1.00
R7038:Pikfyve UTSW 1 65,273,520 (GRCm39) missense probably damaging 1.00
R7044:Pikfyve UTSW 1 65,286,013 (GRCm39) missense probably benign 0.01
R7057:Pikfyve UTSW 1 65,286,364 (GRCm39) missense probably benign 0.00
R7525:Pikfyve UTSW 1 65,283,585 (GRCm39) nonsense probably null
R7558:Pikfyve UTSW 1 65,311,782 (GRCm39) missense probably benign 0.01
R7625:Pikfyve UTSW 1 65,307,036 (GRCm39) missense possibly damaging 0.86
R7807:Pikfyve UTSW 1 65,309,101 (GRCm39) missense probably damaging 1.00
R7961:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8009:Pikfyve UTSW 1 65,294,293 (GRCm39) missense probably damaging 1.00
R8154:Pikfyve UTSW 1 65,304,948 (GRCm39) missense probably damaging 1.00
R8192:Pikfyve UTSW 1 65,285,554 (GRCm39) missense possibly damaging 0.93
R8275:Pikfyve UTSW 1 65,292,501 (GRCm39) splice site probably benign
R8307:Pikfyve UTSW 1 65,284,894 (GRCm39) missense possibly damaging 0.77
R8710:Pikfyve UTSW 1 65,255,155 (GRCm39) missense possibly damaging 0.94
R8867:Pikfyve UTSW 1 65,283,576 (GRCm39) missense probably damaging 1.00
R8936:Pikfyve UTSW 1 65,310,427 (GRCm39) missense possibly damaging 0.84
R8940:Pikfyve UTSW 1 65,286,129 (GRCm39) missense probably benign 0.00
R8995:Pikfyve UTSW 1 65,244,746 (GRCm39) critical splice acceptor site probably null
R9092:Pikfyve UTSW 1 65,283,559 (GRCm39) missense probably damaging 1.00
R9131:Pikfyve UTSW 1 65,285,239 (GRCm39) missense probably damaging 1.00
R9151:Pikfyve UTSW 1 65,235,898 (GRCm39) missense probably damaging 1.00
R9210:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9212:Pikfyve UTSW 1 65,291,719 (GRCm39) missense probably damaging 1.00
R9235:Pikfyve UTSW 1 65,299,188 (GRCm39) missense probably benign 0.37
R9368:Pikfyve UTSW 1 65,307,901 (GRCm39) missense probably damaging 1.00
R9489:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9605:Pikfyve UTSW 1 65,303,561 (GRCm39) missense probably benign
R9686:Pikfyve UTSW 1 65,291,615 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATATTTCCTTTGTCACAGAGCG -3'
(R):5'- TCTCTGCTGAAACCCAAGCAAG -3'

Sequencing Primer
(F):5'- TCCTTTGTCACAGAGCGAGGAG -3'
(R):5'- AATCAAGACATCAGTGCTTGC -3'
Posted On 2014-07-14